Mutagenetix > Incidental Mutation

Incidental Mutation 'R1995:Speer2'

225708

Institutional Source

Beutler Lab

Gene Symbol

Speer2

Ensembl Gene

ENSMUSG00000063163

Gene Name

spermatogenesis associated glutamate (E)-rich protein 2

Synonyms

SPEER-2

MMRRC Submission

040005-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R1995 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69856874-69863744 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 69858077 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 167 (S167P)

Ref Sequence

ENSEMBL: ENSMUSP00000075821 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076500] [ENSMUST00000164146] [ENSMUST00000166256]

AlphaFold

E9Q9U2

Predicted Effect

probably benign
Transcript: ENSMUST00000076500
AA Change: S167P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000075821
Gene: ENSMUSG00000063163
AA Change: S167P

Domain	Start	End	E-Value	Type
Pfam:Takusan	51	137	6.3e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164146

SMART Domains

Protein: ENSMUSP00000126059
Gene: ENSMUSG00000063163

Domain	Start	End	E-Value	Type
Pfam:Takusan	33	121	1.9e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166256

SMART Domains

Protein: ENSMUSP00000130270
Gene: ENSMUSG00000063163

Domain	Start	End	E-Value	Type
Pfam:Takusan	1	49	2.3e-14	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtpbp1	T	G	13: 59,531,058	K145N	probably damaging	Het
AY358078	T	A	14: 51,826,062	D388E	probably damaging	Het
Btbd9	A	G	17: 30,274,930	Y496H	possibly damaging	Het
Catsperb	T	A	12: 101,602,767	N899K	possibly damaging	Het
Ccdc129	T	C	6: 55,968,709	I805T	probably benign	Het
Cenpl	T	C	1: 161,078,424	S123P	probably damaging	Het
Cep120	G	A	18: 53,740,136	T41I	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cnbd1	G	A	4: 19,055,112	P105S	possibly damaging	Het
Col6a1	T	C	10: 76,721,956	N149D	probably damaging	Het
Ctnna3	T	A	10: 63,820,364	V241D	probably damaging	Het
Dcbld2	A	C	16: 58,456,332	E495D	probably benign	Het
Dmp1	T	G	5: 104,209,913	S40A	possibly damaging	Het
Dpysl4	A	G	7: 139,096,770	I379V	probably benign	Het
Eral1	C	T	11: 78,074,489	G367S	probably benign	Het
Fah	C	T	7: 84,602,181	R31Q	probably damaging	Het
Fbn1	T	A	2: 125,350,373		probably null	Het
Fbxo40	T	C	16: 36,969,869	D293G	probably damaging	Het
Gemin6	A	C	17: 80,227,985	T125P	probably damaging	Het
Gpbar1	G	A	1: 74,279,444	G282D	possibly damaging	Het
Gria2	G	A	3: 80,802,357	L10F	probably benign	Het
Gucy1b1	A	G	3: 82,034,853	I533T	probably damaging	Het
H2-M9	A	T	17: 36,641,786	Y123N	probably damaging	Het
Hipk2	C	A	6: 38,715,974	D868Y	probably damaging	Het
Jarid2	T	C	13: 44,874,441	L123P	probably damaging	Het
Kcnb2	C	A	1: 15,709,766	N287K	possibly damaging	Het
Kdm8	G	A	7: 125,452,339	G35S	probably benign	Het
Kirrel	G	T	3: 87,095,786	A100D	possibly damaging	Het
Ltbp2	T	G	12: 84,808,446		probably null	Het
Mfsd12	C	A	10: 81,357,681	H28Q	probably damaging	Het
Neb	C	T	2: 52,298,732	V837M	probably damaging	Het
Nkain2	A	G	10: 32,402,351	I26T	possibly damaging	Het
Nuggc	A	G	14: 65,611,174	R175G	probably benign	Het
Olfr1122	T	G	2: 87,387,831	I42R	probably damaging	Het
Olfr1161	T	A	2: 88,025,672	S317T	probably benign	Het
Olfr205	A	G	16: 59,329,291	S73P	probably damaging	Het
Olfr965	T	C	9: 39,719,413	F62S	probably damaging	Het
Pcnt	G	A	10: 76,392,799	Q1511*	probably null	Het
Piezo2	G	T	18: 63,078,781	T1311K	probably damaging	Het
Pik3c2a	T	C	7: 116,354,006	Y1218C	probably damaging	Het
Pik3r4	T	A	9: 105,669,165	S905T	probably benign	Het
Pikfyve	T	A	1: 65,246,708	D1035E	probably damaging	Het
Pkn3	G	C	2: 30,089,977	G744A	probably damaging	Het
Pms1	A	G	1: 53,195,015	S781P	probably benign	Het
Pogz	C	T	3: 94,877,944	R793W	probably damaging	Het
Prrc2a	A	T	17: 35,157,429	V795D	probably damaging	Het
Rock1	G	A	18: 10,101,026	R630*	probably null	Het
Scd4	T	A	19: 44,334,178	I70N	possibly damaging	Het
Serpine2	A	G	1: 79,821,442	S32P	probably damaging	Het
Slc9c1	A	C	16: 45,554,255	T328P	probably damaging	Het
Spata31d1b	G	C	13: 59,716,380	L447F	probably benign	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Tbcel	C	A	9: 42,451,661	G29W	probably damaging	Het
Tmcc3	T	C	10: 94,578,606	S57P	possibly damaging	Het
Tmem240	T	A	4: 155,739,847	D125E	possibly damaging	Het
Ttll7	G	A	3: 146,961,755	C792Y	possibly damaging	Het
Vmn1r177	T	A	7: 23,865,687	I255F	probably damaging	Het
Zp2	T	A	7: 120,135,165	I554F	probably damaging	Het

Other mutations in Speer2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00693:Speer2	APN	16	69860518	missense	probably benign	0.01
IGL01115:Speer2	APN	16	69861651	nonsense	probably null
IGL01694:Speer2	APN	16	69858112	missense	probably damaging	0.98
IGL01694:Speer2	APN	16	69858113	missense	probably damaging	1.00
IGL02738:Speer2	APN	16	69861712	missense	probably benign
IGL03024:Speer2	APN	16	69858115	missense	possibly damaging	0.95
IGL03062:Speer2	APN	16	69857977	missense	probably damaging	0.96
R0054:Speer2	UTSW	16	69858752	missense	probably damaging	0.99
R1248:Speer2	UTSW	16	69857067	splice site	probably null
R1952:Speer2	UTSW	16	69857164	missense	probably damaging	0.96
R1993:Speer2	UTSW	16	69858077	missense	probably benign	0.01
R2063:Speer2	UTSW	16	69860497	missense	probably benign	0.02
R2155:Speer2	UTSW	16	69860597	missense	possibly damaging	0.63
R2216:Speer2	UTSW	16	69858842	missense	possibly damaging	0.94
R4547:Speer2	UTSW	16	69858849	missense	probably damaging	0.98
R4548:Speer2	UTSW	16	69858849	missense	probably damaging	0.98
R4625:Speer2	UTSW	16	69858754	nonsense	probably null
R4692:Speer2	UTSW	16	69857972	missense	possibly damaging	0.91
R4841:Speer2	UTSW	16	69858100	missense	probably benign	0.26
R4842:Speer2	UTSW	16	69858100	missense	probably benign	0.26
R5035:Speer2	UTSW	16	69857941	critical splice donor site	probably null
R5133:Speer2	UTSW	16	69858820	missense	probably null	0.06
R5812:Speer2	UTSW	16	69858895	missense	possibly damaging	0.82
R6348:Speer2	UTSW	16	69858007	missense	possibly damaging	0.83
R6854:Speer2	UTSW	16	69858887	missense	probably damaging	0.96
R7446:Speer2	UTSW	16	69858077	missense	possibly damaging	0.82
R8068:Speer2	UTSW	16	69860524	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- TGTCAGACAGTATTAGCTTGACTG -3'
(R):5'- TGGGCTGCAGCAATAATTTCTTC -3'

Sequencing Primer
(F):5'- GAGTTGCTTGTCCCTACCTGAAG -3'
(R):5'- CCCTGAAATGGCTGTTTGC -3'

Posted On

2014-08-25