Mutagenetix > Incidental Mutation

Incidental Mutation 'R1995:Btbd9'

225709

Institutional Source

Beutler Lab

Gene Symbol

Btbd9

Ensembl Gene

ENSMUSG00000062202

Gene Name

BTB (POZ) domain containing 9

Synonyms

1700023F20Rik

MMRRC Submission

040005-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1995 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30215524-30576287 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30274930 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 496 (Y496H)

Ref Sequence

ENSEMBL: ENSMUSP00000127300 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079924] [ENSMUST00000168787]

AlphaFold

Q8C726

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079924
AA Change: Y496H

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000078845
Gene: ENSMUSG00000062202
AA Change: Y496H

Domain	Start	End	E-Value	Type
BTB	36	137	3.52e-25	SMART
BACK	143	240	1.84e-18	SMART
Pfam:F5_F8_type_C	283	405	3.9e-11	PFAM
Pfam:F5_F8_type_C	431	554	6.3e-12	PFAM
low complexity region	585	612	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168787
AA Change: Y496H

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000127300
Gene: ENSMUSG00000062202
AA Change: Y496H

Domain	Start	End	E-Value	Type
BTB	36	137	3.52e-25	SMART
BACK	143	240	1.84e-18	SMART
Pfam:F5_F8_type_C	278	405	1.1e-8	PFAM
Pfam:F5_F8_type_C	433	554	1.4e-8	PFAM
low complexity region	585	612	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a BTB/POZ domain-containing protein. This domain is known to be involved in protein-protein interactions. Polymorphisms at this locus have been reported to be associated with susceptibility to Restless Legs Syndrome and may also be associated with Tourette Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele show hyperactivity, unidirectional circling, sleep disturbances, thermal sensory alterations, increased serum iron levels, altered serotonin metabolism, enhanced long-term potentiation and paired-pulse ratios, and enhanced cued and contextual fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtpbp1	T	G	13: 59,531,058	K145N	probably damaging	Het
AY358078	T	A	14: 51,826,062	D388E	probably damaging	Het
Catsperb	T	A	12: 101,602,767	N899K	possibly damaging	Het
Ccdc129	T	C	6: 55,968,709	I805T	probably benign	Het
Cenpl	T	C	1: 161,078,424	S123P	probably damaging	Het
Cep120	G	A	18: 53,740,136	T41I	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cnbd1	G	A	4: 19,055,112	P105S	possibly damaging	Het
Col6a1	T	C	10: 76,721,956	N149D	probably damaging	Het
Ctnna3	T	A	10: 63,820,364	V241D	probably damaging	Het
Dcbld2	A	C	16: 58,456,332	E495D	probably benign	Het
Dmp1	T	G	5: 104,209,913	S40A	possibly damaging	Het
Dpysl4	A	G	7: 139,096,770	I379V	probably benign	Het
Eral1	C	T	11: 78,074,489	G367S	probably benign	Het
Fah	C	T	7: 84,602,181	R31Q	probably damaging	Het
Fbn1	T	A	2: 125,350,373		probably null	Het
Fbxo40	T	C	16: 36,969,869	D293G	probably damaging	Het
Gemin6	A	C	17: 80,227,985	T125P	probably damaging	Het
Gpbar1	G	A	1: 74,279,444	G282D	possibly damaging	Het
Gria2	G	A	3: 80,802,357	L10F	probably benign	Het
Gucy1b1	A	G	3: 82,034,853	I533T	probably damaging	Het
H2-M9	A	T	17: 36,641,786	Y123N	probably damaging	Het
Hipk2	C	A	6: 38,715,974	D868Y	probably damaging	Het
Jarid2	T	C	13: 44,874,441	L123P	probably damaging	Het
Kcnb2	C	A	1: 15,709,766	N287K	possibly damaging	Het
Kdm8	G	A	7: 125,452,339	G35S	probably benign	Het
Kirrel	G	T	3: 87,095,786	A100D	possibly damaging	Het
Ltbp2	T	G	12: 84,808,446		probably null	Het
Mfsd12	C	A	10: 81,357,681	H28Q	probably damaging	Het
Neb	C	T	2: 52,298,732	V837M	probably damaging	Het
Nkain2	A	G	10: 32,402,351	I26T	possibly damaging	Het
Nuggc	A	G	14: 65,611,174	R175G	probably benign	Het
Olfr1122	T	G	2: 87,387,831	I42R	probably damaging	Het
Olfr1161	T	A	2: 88,025,672	S317T	probably benign	Het
Olfr205	A	G	16: 59,329,291	S73P	probably damaging	Het
Olfr965	T	C	9: 39,719,413	F62S	probably damaging	Het
Pcnt	G	A	10: 76,392,799	Q1511*	probably null	Het
Piezo2	G	T	18: 63,078,781	T1311K	probably damaging	Het
Pik3c2a	T	C	7: 116,354,006	Y1218C	probably damaging	Het
Pik3r4	T	A	9: 105,669,165	S905T	probably benign	Het
Pikfyve	T	A	1: 65,246,708	D1035E	probably damaging	Het
Pkn3	G	C	2: 30,089,977	G744A	probably damaging	Het
Pms1	A	G	1: 53,195,015	S781P	probably benign	Het
Pogz	C	T	3: 94,877,944	R793W	probably damaging	Het
Prrc2a	A	T	17: 35,157,429	V795D	probably damaging	Het
Rock1	G	A	18: 10,101,026	R630*	probably null	Het
Scd4	T	A	19: 44,334,178	I70N	possibly damaging	Het
Serpine2	A	G	1: 79,821,442	S32P	probably damaging	Het
Slc9c1	A	C	16: 45,554,255	T328P	probably damaging	Het
Spata31d1b	G	C	13: 59,716,380	L447F	probably benign	Het
Speer2	A	G	16: 69,858,077	S167P	probably benign	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Tbcel	C	A	9: 42,451,661	G29W	probably damaging	Het
Tmcc3	T	C	10: 94,578,606	S57P	possibly damaging	Het
Tmem240	T	A	4: 155,739,847	D125E	possibly damaging	Het
Ttll7	G	A	3: 146,961,755	C792Y	possibly damaging	Het
Vmn1r177	T	A	7: 23,865,687	I255F	probably damaging	Het
Zp2	T	A	7: 120,135,165	I554F	probably damaging	Het

Other mutations in Btbd9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01519:Btbd9	APN	17	30299601	missense	possibly damaging	0.71
IGL01651:Btbd9	APN	17	30220417	missense	unknown
IGL01814:Btbd9	APN	17	30299535	missense	probably benign	0.01
IGL01820:Btbd9	APN	17	30527409	missense	possibly damaging	0.82
IGL02014:Btbd9	APN	17	30517150	missense	probably damaging	0.98
IGL02075:Btbd9	APN	17	30274936	nonsense	probably null
IGL02390:Btbd9	APN	17	30524814	missense	probably benign	0.22
IGL02414:Btbd9	APN	17	30220559	missense	possibly damaging	0.95
IGL02748:Btbd9	APN	17	30334297	missense	possibly damaging	0.81
crumbs	UTSW	17	30299736	splice site	probably null
grain	UTSW	17	30274942	missense	possibly damaging	0.92
R0023:Btbd9	UTSW	17	30530214	missense	probably damaging	0.96
R0023:Btbd9	UTSW	17	30530214	missense	probably damaging	0.96
R0122:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0123:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0134:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0189:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0190:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0226:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0268:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0344:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0427:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0462:Btbd9	UTSW	17	30530217	missense	possibly damaging	0.82
R0645:Btbd9	UTSW	17	30524967	missense	probably damaging	0.96
R0973:Btbd9	UTSW	17	30299633	missense	probably damaging	0.99
R0973:Btbd9	UTSW	17	30299633	missense	probably damaging	0.99
R0974:Btbd9	UTSW	17	30299633	missense	probably damaging	0.99
R1061:Btbd9	UTSW	17	30527435	missense	probably benign	0.00
R1763:Btbd9	UTSW	17	30334297	missense	possibly damaging	0.81
R1781:Btbd9	UTSW	17	30513593	missense	probably damaging	1.00
R1902:Btbd9	UTSW	17	30530228	missense	probably damaging	0.98
R2224:Btbd9	UTSW	17	30527346	missense	probably damaging	0.98
R2237:Btbd9	UTSW	17	30334328	missense	probably benign
R3684:Btbd9	UTSW	17	30334307	missense	probably damaging	0.99
R3800:Btbd9	UTSW	17	30513659	missense	possibly damaging	0.89
R4403:Btbd9	UTSW	17	30485932	intron	probably benign
R4492:Btbd9	UTSW	17	30527571	missense	probably damaging	0.99
R4654:Btbd9	UTSW	17	30485587	intron	probably benign
R4854:Btbd9	UTSW	17	30524865	missense	probably damaging	0.98
R5710:Btbd9	UTSW	17	30228868	missense	probably benign	0.16
R5963:Btbd9	UTSW	17	30334218	splice site	probably null
R6295:Btbd9	UTSW	17	30299736	splice site	probably null
R6422:Btbd9	UTSW	17	30530256	missense	probably benign
R7023:Btbd9	UTSW	17	30527572	missense	probably benign	0.02
R7826:Btbd9	UTSW	17	30334327	missense	probably benign	0.42
R7922:Btbd9	UTSW	17	30274884	missense	probably benign	0.01
R7962:Btbd9	UTSW	17	30517203	missense	probably damaging	0.99
R8265:Btbd9	UTSW	17	30334304	missense	possibly damaging	0.86
R8786:Btbd9	UTSW	17	30530170	missense	probably damaging	0.97
R9541:Btbd9	UTSW	17	30220464	missense	possibly damaging	0.96
R9591:Btbd9	UTSW	17	30517248	missense	probably damaging	1.00
R9703:Btbd9	UTSW	17	30530226	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TCATGGGAATGCGCTTCAC -3'
(R):5'- GTCTGAACTTGGCTGCTAAGGG -3'

Sequencing Primer
(F):5'- GGAATGCGCTTCACCTCCC -3'
(R):5'- AAGATGGGACCCACAGCCTG -3'

Posted On

2014-08-25