Incidental Mutation 'R1995:Rock1'
ID 225713
Institutional Source Beutler Lab
Gene Symbol Rock1
Ensembl Gene ENSMUSG00000024290
Gene Name Rho-associated coiled-coil containing protein kinase 1
Synonyms 1110055K06Rik, Rock-I
MMRRC Submission 040005-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock # R1995 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 10064401-10181792 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 10101026 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 630 (R630*)
Ref Sequence ENSEMBL: ENSMUSP00000069549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067947]
AlphaFold P70335
Predicted Effect probably null
Transcript: ENSMUST00000067947
AA Change: R630*
SMART Domains Protein: ENSMUSP00000069549
Gene: ENSMUSG00000024290
AA Change: R630*

DomainStartEndE-ValueType
S_TKc 76 338 4.07e-97 SMART
S_TK_X 341 401 4.02e-9 SMART
low complexity region 408 419 N/A INTRINSIC
PDB:3O0Z|D 535 700 1e-101 PDB
low complexity region 715 731 N/A INTRINSIC
PDB:4L2W|B 832 914 7e-28 PDB
Pfam:Rho_Binding 948 1014 4.3e-26 PFAM
PH 1119 1319 1.19e-6 SMART
C1 1229 1283 2.64e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein serine/threonine kinase that is activated when bound to the GTP-bound form of Rho. The small GTPase Rho regulates formation of focal adhesions and stress fibers of fibroblasts, as well as adhesion and aggregation of platelets and lymphocytes by shuttling between the inactive GDP-bound form and the active GTP-bound form. Rho is also essential in cytokinesis and plays a role in transcriptional activation by serum response factor. This protein, a downstream effector of Rho, phosphorylates and activates LIM kinase, which in turn, phosphorylates cofilin, inhibiting its actin-depolymerizing activity. A pseudogene, related to this gene, is also located on chromosome 18. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice have open eyes at birth, omphalocele and most die soon after birth as a result of cannibalization by the mom. Survivors develop inflammation of the eyelid. Another homozygous mutant shows partial lethality around implantation and reduced cardiac fibrosis after pressure overload. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Btbd9 A G 17: 30,274,930 Y496H possibly damaging Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc129 T C 6: 55,968,709 I805T probably benign Het
Cenpl T C 1: 161,078,424 S123P probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 P105S possibly damaging Het
Col6a1 T C 10: 76,721,956 N149D probably damaging Het
Ctnna3 T A 10: 63,820,364 V241D probably damaging Het
Dcbld2 A C 16: 58,456,332 E495D probably benign Het
Dmp1 T G 5: 104,209,913 S40A possibly damaging Het
Dpysl4 A G 7: 139,096,770 I379V probably benign Het
Eral1 C T 11: 78,074,489 G367S probably benign Het
Fah C T 7: 84,602,181 R31Q probably damaging Het
Fbn1 T A 2: 125,350,373 probably null Het
Fbxo40 T C 16: 36,969,869 D293G probably damaging Het
Gemin6 A C 17: 80,227,985 T125P probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gucy1b1 A G 3: 82,034,853 I533T probably damaging Het
H2-M9 A T 17: 36,641,786 Y123N probably damaging Het
Hipk2 C A 6: 38,715,974 D868Y probably damaging Het
Jarid2 T C 13: 44,874,441 L123P probably damaging Het
Kcnb2 C A 1: 15,709,766 N287K possibly damaging Het
Kdm8 G A 7: 125,452,339 G35S probably benign Het
Kirrel G T 3: 87,095,786 A100D possibly damaging Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Neb C T 2: 52,298,732 V837M probably damaging Het
Nkain2 A G 10: 32,402,351 I26T possibly damaging Het
Nuggc A G 14: 65,611,174 R175G probably benign Het
Olfr1122 T G 2: 87,387,831 I42R probably damaging Het
Olfr1161 T A 2: 88,025,672 S317T probably benign Het
Olfr205 A G 16: 59,329,291 S73P probably damaging Het
Olfr965 T C 9: 39,719,413 F62S probably damaging Het
Pcnt G A 10: 76,392,799 Q1511* probably null Het
Piezo2 G T 18: 63,078,781 T1311K probably damaging Het
Pik3c2a T C 7: 116,354,006 Y1218C probably damaging Het
Pik3r4 T A 9: 105,669,165 S905T probably benign Het
Pikfyve T A 1: 65,246,708 D1035E probably damaging Het
Pkn3 G C 2: 30,089,977 G744A probably damaging Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Pogz C T 3: 94,877,944 R793W probably damaging Het
Prrc2a A T 17: 35,157,429 V795D probably damaging Het
Scd4 T A 19: 44,334,178 I70N possibly damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Slc9c1 A C 16: 45,554,255 T328P probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Tbcel C A 9: 42,451,661 G29W probably damaging Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Tmem240 T A 4: 155,739,847 D125E possibly damaging Het
Ttll7 G A 3: 146,961,755 C792Y possibly damaging Het
Vmn1r177 T A 7: 23,865,687 I255F probably damaging Het
Zp2 T A 7: 120,135,165 I554F probably damaging Het
Other mutations in Rock1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Rock1 APN 18 10080502 missense probably benign 0.44
IGL01535:Rock1 APN 18 10132119 splice site probably benign
IGL01751:Rock1 APN 18 10079113 critical splice donor site probably null
IGL01752:Rock1 APN 18 10079113 critical splice donor site probably null
IGL02318:Rock1 APN 18 10104323 splice site probably benign
IGL02420:Rock1 APN 18 10070619 splice site probably null
IGL03030:Rock1 APN 18 10070215 splice site probably benign
IGL03339:Rock1 APN 18 10097493 missense probably benign 0.00
R0010:Rock1 UTSW 18 10084380 missense probably damaging 0.99
R0010:Rock1 UTSW 18 10084380 missense probably damaging 0.99
R0041:Rock1 UTSW 18 10140240 missense probably damaging 1.00
R0041:Rock1 UTSW 18 10140240 missense probably damaging 1.00
R0480:Rock1 UTSW 18 10079120 missense possibly damaging 0.92
R0538:Rock1 UTSW 18 10132227 missense possibly damaging 0.53
R0719:Rock1 UTSW 18 10099328 missense probably damaging 1.00
R1033:Rock1 UTSW 18 10067535 missense probably benign 0.12
R1448:Rock1 UTSW 18 10070233 missense probably damaging 1.00
R1465:Rock1 UTSW 18 10072863 missense possibly damaging 0.80
R1465:Rock1 UTSW 18 10072863 missense possibly damaging 0.80
R1470:Rock1 UTSW 18 10136091 splice site probably null
R1470:Rock1 UTSW 18 10136091 splice site probably null
R1694:Rock1 UTSW 18 10136094 critical splice donor site probably null
R1862:Rock1 UTSW 18 10079207 missense probably damaging 0.99
R2177:Rock1 UTSW 18 10070263 missense probably benign 0.18
R2892:Rock1 UTSW 18 10072863 nonsense probably null
R3780:Rock1 UTSW 18 10067575 missense probably benign 0.00
R3884:Rock1 UTSW 18 10122768 missense probably damaging 1.00
R4352:Rock1 UTSW 18 10079237 missense probably damaging 1.00
R4414:Rock1 UTSW 18 10080514 missense probably damaging 1.00
R4646:Rock1 UTSW 18 10112391 missense probably benign
R4694:Rock1 UTSW 18 10136152 nonsense probably null
R4888:Rock1 UTSW 18 10122698 missense probably benign 0.06
R5085:Rock1 UTSW 18 10140210 missense probably damaging 1.00
R5884:Rock1 UTSW 18 10099361 missense probably benign 0.03
R5927:Rock1 UTSW 18 10116792 missense probably damaging 1.00
R6084:Rock1 UTSW 18 10101007 missense probably benign 0.15
R6151:Rock1 UTSW 18 10106426 missense possibly damaging 0.79
R6360:Rock1 UTSW 18 10116778 missense possibly damaging 0.52
R6892:Rock1 UTSW 18 10122612 missense probably benign 0.00
R7313:Rock1 UTSW 18 10129317 missense possibly damaging 0.73
R7397:Rock1 UTSW 18 10097599 missense possibly damaging 0.80
R7488:Rock1 UTSW 18 10122762 missense probably damaging 1.00
R7515:Rock1 UTSW 18 10067631 missense probably damaging 0.97
R7567:Rock1 UTSW 18 10090820 missense probably benign 0.35
R7569:Rock1 UTSW 18 10140194 missense probably damaging 1.00
R7639:Rock1 UTSW 18 10140244 missense probably damaging 1.00
R7836:Rock1 UTSW 18 10097651 splice site probably null
R7844:Rock1 UTSW 18 10104173 missense probably damaging 0.99
R7943:Rock1 UTSW 18 10112357 missense probably damaging 1.00
R7945:Rock1 UTSW 18 10116831 missense probably damaging 1.00
R8421:Rock1 UTSW 18 10072863 nonsense probably null
R8801:Rock1 UTSW 18 10070260 missense probably damaging 1.00
R8819:Rock1 UTSW 18 10070626 missense probably damaging 1.00
R9281:Rock1 UTSW 18 10080479 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCATACATACATTCCCATATACCAGG -3'
(R):5'- ACCATTTAAGAGGCTGTTTCTTCC -3'

Sequencing Primer
(F):5'- ATTCCCATATACCAGGAAAACAATC -3'
(R):5'- AGTCCTAGTAGACCCATTGCC -3'
Posted On 2014-08-25