Mutagenetix > Incidental Mutation

Incidental Mutation 'R1995:Rock1'

225713

Institutional Source

Beutler Lab

Gene Symbol

Rock1

Ensembl Gene

ENSMUSG00000024290

Gene Name

Rho-associated coiled-coil containing protein kinase 1

Synonyms

1110055K06Rik, Rock-I

MMRRC Submission

040005-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R1995 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10064401-10181792 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 10101026 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 630 (R630*)

Ref Sequence

ENSEMBL: ENSMUSP00000069549 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067947]

AlphaFold

P70335

Predicted Effect

probably null
Transcript: ENSMUST00000067947
AA Change: R630*

SMART Domains

Protein: ENSMUSP00000069549
Gene: ENSMUSG00000024290
AA Change: R630*

Domain	Start	End	E-Value	Type
S_TKc	76	338	4.07e-97	SMART
S_TK_X	341	401	4.02e-9	SMART
low complexity region	408	419	N/A	INTRINSIC
PDB:3O0Z\|D	535	700	1e-101	PDB
low complexity region	715	731	N/A	INTRINSIC
PDB:4L2W\|B	832	914	7e-28	PDB
Pfam:Rho_Binding	948	1014	4.3e-26	PFAM
PH	1119	1319	1.19e-6	SMART
C1	1229	1283	2.64e-10	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein serine/threonine kinase that is activated when bound to the GTP-bound form of Rho. The small GTPase Rho regulates formation of focal adhesions and stress fibers of fibroblasts, as well as adhesion and aggregation of platelets and lymphocytes by shuttling between the inactive GDP-bound form and the active GTP-bound form. Rho is also essential in cytokinesis and plays a role in transcriptional activation by serum response factor. This protein, a downstream effector of Rho, phosphorylates and activates LIM kinase, which in turn, phosphorylates cofilin, inhibiting its actin-depolymerizing activity. A pseudogene, related to this gene, is also located on chromosome 18. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice have open eyes at birth, omphalocele and most die soon after birth as a result of cannibalization by the mom. Survivors develop inflammation of the eyelid. Another homozygous mutant shows partial lethality around implantation and reduced cardiac fibrosis after pressure overload. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtpbp1	T	G	13: 59,531,058	K145N	probably damaging	Het
AY358078	T	A	14: 51,826,062	D388E	probably damaging	Het
Btbd9	A	G	17: 30,274,930	Y496H	possibly damaging	Het
Catsperb	T	A	12: 101,602,767	N899K	possibly damaging	Het
Ccdc129	T	C	6: 55,968,709	I805T	probably benign	Het
Cenpl	T	C	1: 161,078,424	S123P	probably damaging	Het
Cep120	G	A	18: 53,740,136	T41I	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cnbd1	G	A	4: 19,055,112	P105S	possibly damaging	Het
Col6a1	T	C	10: 76,721,956	N149D	probably damaging	Het
Ctnna3	T	A	10: 63,820,364	V241D	probably damaging	Het
Dcbld2	A	C	16: 58,456,332	E495D	probably benign	Het
Dmp1	T	G	5: 104,209,913	S40A	possibly damaging	Het
Dpysl4	A	G	7: 139,096,770	I379V	probably benign	Het
Eral1	C	T	11: 78,074,489	G367S	probably benign	Het
Fah	C	T	7: 84,602,181	R31Q	probably damaging	Het
Fbn1	T	A	2: 125,350,373		probably null	Het
Fbxo40	T	C	16: 36,969,869	D293G	probably damaging	Het
Gemin6	A	C	17: 80,227,985	T125P	probably damaging	Het
Gpbar1	G	A	1: 74,279,444	G282D	possibly damaging	Het
Gria2	G	A	3: 80,802,357	L10F	probably benign	Het
Gucy1b1	A	G	3: 82,034,853	I533T	probably damaging	Het
H2-M9	A	T	17: 36,641,786	Y123N	probably damaging	Het
Hipk2	C	A	6: 38,715,974	D868Y	probably damaging	Het
Jarid2	T	C	13: 44,874,441	L123P	probably damaging	Het
Kcnb2	C	A	1: 15,709,766	N287K	possibly damaging	Het
Kdm8	G	A	7: 125,452,339	G35S	probably benign	Het
Kirrel	G	T	3: 87,095,786	A100D	possibly damaging	Het
Ltbp2	T	G	12: 84,808,446		probably null	Het
Mfsd12	C	A	10: 81,357,681	H28Q	probably damaging	Het
Neb	C	T	2: 52,298,732	V837M	probably damaging	Het
Nkain2	A	G	10: 32,402,351	I26T	possibly damaging	Het
Nuggc	A	G	14: 65,611,174	R175G	probably benign	Het
Olfr1122	T	G	2: 87,387,831	I42R	probably damaging	Het
Olfr1161	T	A	2: 88,025,672	S317T	probably benign	Het
Olfr205	A	G	16: 59,329,291	S73P	probably damaging	Het
Olfr965	T	C	9: 39,719,413	F62S	probably damaging	Het
Pcnt	G	A	10: 76,392,799	Q1511*	probably null	Het
Piezo2	G	T	18: 63,078,781	T1311K	probably damaging	Het
Pik3c2a	T	C	7: 116,354,006	Y1218C	probably damaging	Het
Pik3r4	T	A	9: 105,669,165	S905T	probably benign	Het
Pikfyve	T	A	1: 65,246,708	D1035E	probably damaging	Het
Pkn3	G	C	2: 30,089,977	G744A	probably damaging	Het
Pms1	A	G	1: 53,195,015	S781P	probably benign	Het
Pogz	C	T	3: 94,877,944	R793W	probably damaging	Het
Prrc2a	A	T	17: 35,157,429	V795D	probably damaging	Het
Scd4	T	A	19: 44,334,178	I70N	possibly damaging	Het
Serpine2	A	G	1: 79,821,442	S32P	probably damaging	Het
Slc9c1	A	C	16: 45,554,255	T328P	probably damaging	Het
Spata31d1b	G	C	13: 59,716,380	L447F	probably benign	Het
Speer2	A	G	16: 69,858,077	S167P	probably benign	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Tbcel	C	A	9: 42,451,661	G29W	probably damaging	Het
Tmcc3	T	C	10: 94,578,606	S57P	possibly damaging	Het
Tmem240	T	A	4: 155,739,847	D125E	possibly damaging	Het
Ttll7	G	A	3: 146,961,755	C792Y	possibly damaging	Het
Vmn1r177	T	A	7: 23,865,687	I255F	probably damaging	Het
Zp2	T	A	7: 120,135,165	I554F	probably damaging	Het

Other mutations in Rock1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Rock1	APN	18	10080502	missense	probably benign	0.44
IGL01535:Rock1	APN	18	10132119	splice site	probably benign
IGL01751:Rock1	APN	18	10079113	critical splice donor site	probably null
IGL01752:Rock1	APN	18	10079113	critical splice donor site	probably null
IGL02318:Rock1	APN	18	10104323	splice site	probably benign
IGL02420:Rock1	APN	18	10070619	splice site	probably null
IGL03030:Rock1	APN	18	10070215	splice site	probably benign
IGL03339:Rock1	APN	18	10097493	missense	probably benign	0.00
R0010:Rock1	UTSW	18	10084380	missense	probably damaging	0.99
R0010:Rock1	UTSW	18	10084380	missense	probably damaging	0.99
R0041:Rock1	UTSW	18	10140240	missense	probably damaging	1.00
R0041:Rock1	UTSW	18	10140240	missense	probably damaging	1.00
R0480:Rock1	UTSW	18	10079120	missense	possibly damaging	0.92
R0538:Rock1	UTSW	18	10132227	missense	possibly damaging	0.53
R0719:Rock1	UTSW	18	10099328	missense	probably damaging	1.00
R1033:Rock1	UTSW	18	10067535	missense	probably benign	0.12
R1448:Rock1	UTSW	18	10070233	missense	probably damaging	1.00
R1465:Rock1	UTSW	18	10072863	missense	possibly damaging	0.80
R1465:Rock1	UTSW	18	10072863	missense	possibly damaging	0.80
R1470:Rock1	UTSW	18	10136091	splice site	probably null
R1470:Rock1	UTSW	18	10136091	splice site	probably null
R1694:Rock1	UTSW	18	10136094	critical splice donor site	probably null
R1862:Rock1	UTSW	18	10079207	missense	probably damaging	0.99
R2177:Rock1	UTSW	18	10070263	missense	probably benign	0.18
R2892:Rock1	UTSW	18	10072863	nonsense	probably null
R3780:Rock1	UTSW	18	10067575	missense	probably benign	0.00
R3884:Rock1	UTSW	18	10122768	missense	probably damaging	1.00
R4352:Rock1	UTSW	18	10079237	missense	probably damaging	1.00
R4414:Rock1	UTSW	18	10080514	missense	probably damaging	1.00
R4646:Rock1	UTSW	18	10112391	missense	probably benign
R4694:Rock1	UTSW	18	10136152	nonsense	probably null
R4888:Rock1	UTSW	18	10122698	missense	probably benign	0.06
R5085:Rock1	UTSW	18	10140210	missense	probably damaging	1.00
R5884:Rock1	UTSW	18	10099361	missense	probably benign	0.03
R5927:Rock1	UTSW	18	10116792	missense	probably damaging	1.00
R6084:Rock1	UTSW	18	10101007	missense	probably benign	0.15
R6151:Rock1	UTSW	18	10106426	missense	possibly damaging	0.79
R6360:Rock1	UTSW	18	10116778	missense	possibly damaging	0.52
R6892:Rock1	UTSW	18	10122612	missense	probably benign	0.00
R7313:Rock1	UTSW	18	10129317	missense	possibly damaging	0.73
R7397:Rock1	UTSW	18	10097599	missense	possibly damaging	0.80
R7488:Rock1	UTSW	18	10122762	missense	probably damaging	1.00
R7515:Rock1	UTSW	18	10067631	missense	probably damaging	0.97
R7567:Rock1	UTSW	18	10090820	missense	probably benign	0.35
R7569:Rock1	UTSW	18	10140194	missense	probably damaging	1.00
R7639:Rock1	UTSW	18	10140244	missense	probably damaging	1.00
R7836:Rock1	UTSW	18	10097651	splice site	probably null
R7844:Rock1	UTSW	18	10104173	missense	probably damaging	0.99
R7943:Rock1	UTSW	18	10112357	missense	probably damaging	1.00
R7945:Rock1	UTSW	18	10116831	missense	probably damaging	1.00
R8421:Rock1	UTSW	18	10072863	nonsense	probably null
R8801:Rock1	UTSW	18	10070260	missense	probably damaging	1.00
R8819:Rock1	UTSW	18	10070626	missense	probably damaging	1.00
R9281:Rock1	UTSW	18	10080479	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TGCATACATACATTCCCATATACCAGG -3'
(R):5'- ACCATTTAAGAGGCTGTTTCTTCC -3'

Sequencing Primer
(F):5'- ATTCCCATATACCAGGAAAACAATC -3'
(R):5'- AGTCCTAGTAGACCCATTGCC -3'

Posted On

2014-08-25