Incidental Mutation 'R1995:Cep120'
ID 225714
Institutional Source Beutler Lab
Gene Symbol Cep120
Ensembl Gene ENSMUSG00000048799
Gene Name centrosomal protein 120
Synonyms Ccdc100
MMRRC Submission 040005-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock # R1995 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 53681724-53744547 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 53740136 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 41 (T41I)
Ref Sequence ENSEMBL: ENSMUSP00000062433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049811]
AlphaFold Q7TSG1
Predicted Effect probably damaging
Transcript: ENSMUST00000049811
AA Change: T41I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062433
Gene: ENSMUSG00000048799
AA Change: T41I

DomainStartEndE-ValueType
Pfam:C2 9 114 4.8e-5 PFAM
Pfam:DUF3668 118 340 1e-96 PFAM
low complexity region 378 396 N/A INTRINSIC
Pfam:C2 520 568 1.9e-3 PFAM
low complexity region 632 642 N/A INTRINSIC
SCOP:d1eq1a_ 661 803 2e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the microtubule-dependent coupling of the nucleus and the centrosome. A similar protein in mouse plays a role in both interkinetic nuclear migration, which is a characteristic pattern of nuclear movement in neural progenitors, and in neural progenitor self-renewal. Mutations in this gene are predicted to result in neurogenic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth arrest at E8.5 and die during organogenesis exhibiting abnormal direction of heart looping. Primary mouse embryonic fibroblasts lack cilia and either one or both centrioles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Btbd9 A G 17: 30,274,930 Y496H possibly damaging Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc129 T C 6: 55,968,709 I805T probably benign Het
Cenpl T C 1: 161,078,424 S123P probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 P105S possibly damaging Het
Col6a1 T C 10: 76,721,956 N149D probably damaging Het
Ctnna3 T A 10: 63,820,364 V241D probably damaging Het
Dcbld2 A C 16: 58,456,332 E495D probably benign Het
Dmp1 T G 5: 104,209,913 S40A possibly damaging Het
Dpysl4 A G 7: 139,096,770 I379V probably benign Het
Eral1 C T 11: 78,074,489 G367S probably benign Het
Fah C T 7: 84,602,181 R31Q probably damaging Het
Fbn1 T A 2: 125,350,373 probably null Het
Fbxo40 T C 16: 36,969,869 D293G probably damaging Het
Gemin6 A C 17: 80,227,985 T125P probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gucy1b1 A G 3: 82,034,853 I533T probably damaging Het
H2-M9 A T 17: 36,641,786 Y123N probably damaging Het
Hipk2 C A 6: 38,715,974 D868Y probably damaging Het
Jarid2 T C 13: 44,874,441 L123P probably damaging Het
Kcnb2 C A 1: 15,709,766 N287K possibly damaging Het
Kdm8 G A 7: 125,452,339 G35S probably benign Het
Kirrel G T 3: 87,095,786 A100D possibly damaging Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Neb C T 2: 52,298,732 V837M probably damaging Het
Nkain2 A G 10: 32,402,351 I26T possibly damaging Het
Nuggc A G 14: 65,611,174 R175G probably benign Het
Olfr1122 T G 2: 87,387,831 I42R probably damaging Het
Olfr1161 T A 2: 88,025,672 S317T probably benign Het
Olfr205 A G 16: 59,329,291 S73P probably damaging Het
Olfr965 T C 9: 39,719,413 F62S probably damaging Het
Pcnt G A 10: 76,392,799 Q1511* probably null Het
Piezo2 G T 18: 63,078,781 T1311K probably damaging Het
Pik3c2a T C 7: 116,354,006 Y1218C probably damaging Het
Pik3r4 T A 9: 105,669,165 S905T probably benign Het
Pikfyve T A 1: 65,246,708 D1035E probably damaging Het
Pkn3 G C 2: 30,089,977 G744A probably damaging Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Pogz C T 3: 94,877,944 R793W probably damaging Het
Prrc2a A T 17: 35,157,429 V795D probably damaging Het
Rock1 G A 18: 10,101,026 R630* probably null Het
Scd4 T A 19: 44,334,178 I70N possibly damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Slc9c1 A C 16: 45,554,255 T328P probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Tbcel C A 9: 42,451,661 G29W probably damaging Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Tmem240 T A 4: 155,739,847 D125E possibly damaging Het
Ttll7 G A 3: 146,961,755 C792Y possibly damaging Het
Vmn1r177 T A 7: 23,865,687 I255F probably damaging Het
Zp2 T A 7: 120,135,165 I554F probably damaging Het
Other mutations in Cep120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Cep120 APN 18 53685961 missense probably benign 0.24
IGL01774:Cep120 APN 18 53706830 missense possibly damaging 0.92
IGL01862:Cep120 APN 18 53714767 missense probably benign 0.01
IGL01906:Cep120 APN 18 53714912 missense probably benign
IGL01941:Cep120 APN 18 53723148 missense probably benign 0.00
IGL02952:Cep120 APN 18 53683228 utr 3 prime probably benign
IGL03248:Cep120 APN 18 53735772 missense probably benign 0.04
IGL03379:Cep120 APN 18 53709136 missense probably benign
R0019:Cep120 UTSW 18 53709047 splice site probably benign
R0039:Cep120 UTSW 18 53685961 missense probably benign 0.24
R0763:Cep120 UTSW 18 53721737 missense probably benign 0.00
R1015:Cep120 UTSW 18 53703121 critical splice donor site probably null
R1340:Cep120 UTSW 18 53724391 missense probably damaging 1.00
R1507:Cep120 UTSW 18 53697657 missense probably damaging 0.99
R1649:Cep120 UTSW 18 53724576 missense probably damaging 1.00
R1727:Cep120 UTSW 18 53727729 missense probably benign 0.01
R1739:Cep120 UTSW 18 53719214 critical splice donor site probably null
R1873:Cep120 UTSW 18 53738488 missense probably damaging 0.98
R1913:Cep120 UTSW 18 53723286 missense probably benign 0.26
R1968:Cep120 UTSW 18 53723241 missense probably benign 0.42
R2042:Cep120 UTSW 18 53735742 missense possibly damaging 0.50
R2074:Cep120 UTSW 18 53719312 missense possibly damaging 0.83
R2116:Cep120 UTSW 18 53740136 missense probably damaging 1.00
R2215:Cep120 UTSW 18 53727635 missense probably damaging 1.00
R2697:Cep120 UTSW 18 53740125 missense probably benign 0.00
R3813:Cep120 UTSW 18 53740212 splice site probably benign
R4012:Cep120 UTSW 18 53738582 missense probably damaging 0.99
R4368:Cep120 UTSW 18 53685885 splice site probably null
R4615:Cep120 UTSW 18 53714841 missense probably damaging 1.00
R4772:Cep120 UTSW 18 53718489 missense probably damaging 1.00
R4780:Cep120 UTSW 18 53724536 missense probably benign 0.12
R5195:Cep120 UTSW 18 53721698 missense probably damaging 1.00
R5991:Cep120 UTSW 18 53721798 missense probably benign
R6156:Cep120 UTSW 18 53703223 missense probably benign 0.00
R6188:Cep120 UTSW 18 53724457 missense probably benign 0.03
R6688:Cep120 UTSW 18 53724536 missense probably benign 0.12
R6961:Cep120 UTSW 18 53703205 nonsense probably null
R7143:Cep120 UTSW 18 53683385 missense probably benign 0.00
R7282:Cep120 UTSW 18 53740089 missense probably damaging 1.00
R7813:Cep120 UTSW 18 53738506 missense probably damaging 1.00
R7818:Cep120 UTSW 18 53723103 missense probably benign
R8677:Cep120 UTSW 18 53738561 missense possibly damaging 0.90
R8724:Cep120 UTSW 18 53723127 missense possibly damaging 0.88
R9164:Cep120 UTSW 18 53719246 missense probably benign 0.02
R9225:Cep120 UTSW 18 53706824 missense probably benign 0.00
R9300:Cep120 UTSW 18 53719297 missense probably damaging 0.99
R9312:Cep120 UTSW 18 53727641 missense probably benign 0.08
R9377:Cep120 UTSW 18 53718520 missense possibly damaging 0.66
R9390:Cep120 UTSW 18 53706912 nonsense probably null
R9499:Cep120 UTSW 18 53685961 missense possibly damaging 0.94
R9551:Cep120 UTSW 18 53685961 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACCCTGTCTCAAGAGCAGAAATG -3'
(R):5'- TTATGCAACATGTCCGCCG -3'

Sequencing Primer
(F):5'- TGTCTCAAGAGCAGAAATGCAAAAAC -3'
(R):5'- AACATGTCCGCCGGTCAG -3'
Posted On 2014-08-25