Incidental Mutation 'R1996:Cep135'
ID225732
Institutional Source Beutler Lab
Gene Symbol Cep135
Ensembl Gene ENSMUSG00000036403
Gene Namecentrosomal protein 135
SynonymsLOC381644, Cep4
MMRRC Submission 040006-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1996 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location76588698-76646466 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76632266 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 815 (I815T)
Ref Sequence ENSEMBL: ENSMUSP00000112602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049060] [ENSMUST00000121979]
Predicted Effect probably benign
Transcript: ENSMUST00000049060
AA Change: I815T

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000038674
Gene: ENSMUSG00000036403
AA Change: I815T

DomainStartEndE-ValueType
internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121979
AA Change: I815T

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112602
Gene: ENSMUSG00000036403
AA Change: I815T

DomainStartEndE-ValueType
internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130651
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein, which acts as a scaffolding protein during early centriole biogenesis, and is also required for centriole-centriole cohesion during interphase. Mutations in this gene are associated with autosomal recessive primary microcephaly-8. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,669,597 W1069R probably damaging Het
Aaas C T 15: 102,340,059 V241I probably benign Het
Abca3 A G 17: 24,387,532 E787G probably damaging Het
Abi3bp A T 16: 56,671,357 E582D possibly damaging Het
Adam21 A G 12: 81,559,602 M462T possibly damaging Het
Alox12e T C 11: 70,316,208 T591A probably benign Het
Ankmy2 T C 12: 36,193,797 M337T probably benign Het
Antxrl A G 14: 34,075,829 N587S probably benign Het
Apol6 T A 15: 77,050,756 I75N probably benign Het
Atad2b A T 12: 4,990,883 H184L probably benign Het
Atf6b A T 17: 34,652,987 probably null Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B3gnt4 G A 5: 123,511,339 V256I probably damaging Het
BC034090 C T 1: 155,221,594 probably benign Het
Bend4 C A 5: 67,400,184 V430F probably damaging Het
Camkv A G 9: 107,947,121 D244G probably damaging Het
Caps2 T A 10: 112,204,003 L450Q probably damaging Het
Ccr1 T A 9: 123,963,514 K326N probably benign Het
Chchd4 A G 6: 91,465,134 Y101H probably damaging Het
Copb1 G C 7: 114,232,203 A570G probably benign Het
Cpsf2 C A 12: 101,998,608 T505K probably benign Het
Cwf19l2 A G 9: 3,417,947 R136G probably benign Het
Daxx A G 17: 33,913,611 T572A possibly damaging Het
Etaa1 C A 11: 17,952,671 D89Y probably damaging Het
Fchsd2 T C 7: 101,278,453 F701L probably benign Het
Fstl5 A T 3: 76,707,834 H734L probably benign Het
Gabbr1 T A 17: 37,069,220 W584R probably damaging Het
Galc T C 12: 98,252,026 D189G probably damaging Het
Gm4778 A T 3: 94,265,711 M9L probably benign Het
Gm9979 T C 13: 40,705,752 noncoding transcript Het
Grin2b T C 6: 136,044,211 S31G possibly damaging Het
Gtf2ird1 T C 5: 134,376,886 probably benign Het
Hoxc4 T C 15: 103,035,757 I187T probably damaging Het
Hsd3b6 A T 3: 98,806,281 I234N probably damaging Het
Ifit3b T C 19: 34,611,477 C18R probably damaging Het
Igdcc4 T A 9: 65,121,819 V246E probably damaging Het
Il1rap A T 16: 26,722,493 T495S probably benign Het
Kctd19 T C 8: 105,395,300 E205G probably null Het
Kif21a A T 15: 90,994,371 C235* probably null Het
Krt16 A T 11: 100,248,788 S35T unknown Het
Lamc2 T C 1: 153,154,470 D142G possibly damaging Het
Larp4 G T 15: 99,984,963 W22L probably damaging Het
Ldlrad1 C T 4: 107,214,961 R127* probably null Het
Mamdc2 G A 19: 23,363,925 Q229* probably null Het
Mbtd1 CT CTT 11: 93,932,396 probably null Het
Msln T A 17: 25,754,219 M1L possibly damaging Het
Mtch2 T C 2: 90,847,321 V8A possibly damaging Het
Nav3 A T 10: 109,853,401 N338K probably damaging Het
Olfr248 T C 1: 174,391,417 M116T probably damaging Het
Olfr33 A G 7: 102,713,792 L207P probably damaging Het
Olfr774 C A 10: 129,238,429 N93K possibly damaging Het
Otof A G 5: 30,421,037 V89A probably benign Het
Phka2 T C X: 160,541,415 I255T probably benign Het
Pias2 T C 18: 77,129,063 probably null Het
Pja2 T A 17: 64,287,644 probably null Het
Plxnb2 C T 15: 89,158,768 V1473I probably benign Het
Pnpt1 T A 11: 29,141,679 D363E probably benign Het
Prdm5 A G 6: 65,936,088 Y207C probably damaging Het
Rexo5 T A 7: 119,823,857 V304E probably damaging Het
Robo1 G T 16: 72,970,179 R413L probably benign Het
Rsf1 G A 7: 97,664,632 E864K probably damaging Het
Scap C T 9: 110,372,971 probably benign Het
Scn8a T A 15: 101,024,379 M1311K probably damaging Het
Slc28a2 A T 2: 122,455,562 I460F probably damaging Het
Smco1 A G 16: 32,273,912 R134G probably benign Het
Sspo A G 6: 48,475,490 E2651G possibly damaging Het
Stab2 T C 10: 87,003,031 N57S probably damaging Het
Tenm3 C A 8: 48,228,668 Q2642H probably damaging Het
Thsd7b G T 1: 129,758,451 E577* probably null Het
Tlr3 A G 8: 45,397,697 V721A probably benign Het
Tnik A G 3: 28,665,680 I1226V probably damaging Het
Traf3 A G 12: 111,260,661 K328E probably benign Het
Tyw1 T A 5: 130,262,811 probably benign Het
Vmn1r213 T G 13: 23,012,303 V352G probably benign Het
Vmn2r111 T C 17: 22,548,081 I812V probably benign Het
Vmn2r26 A G 6: 124,061,185 N573S probably damaging Het
Vmn2r45 G A 7: 8,472,025 T668I probably damaging Het
Zbtb20 T A 16: 43,610,080 V318E probably damaging Het
Zc2hc1c A G 12: 85,296,660 R524G probably benign Het
Zc3h18 C G 8: 122,407,387 probably benign Het
Zfp618 T C 4: 63,131,215 probably null Het
Other mutations in Cep135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cep135 APN 5 76601459 missense probably damaging 0.98
IGL01154:Cep135 APN 5 76606796 splice site probably benign
IGL01323:Cep135 APN 5 76591765 missense probably benign 0.29
IGL01599:Cep135 APN 5 76593347 missense possibly damaging 0.93
IGL01923:Cep135 APN 5 76640982 makesense probably null
IGL02178:Cep135 APN 5 76595474 missense probably damaging 1.00
IGL02276:Cep135 APN 5 76634246 missense probably benign 0.00
IGL02344:Cep135 APN 5 76616821 missense probably benign
IGL02394:Cep135 APN 5 76631471 missense probably benign 0.02
IGL02740:Cep135 APN 5 76638268 critical splice donor site probably null
IGL02832:Cep135 APN 5 76640949 missense probably damaging 0.98
R0026:Cep135 UTSW 5 76606734 nonsense probably null
R0060:Cep135 UTSW 5 76621350 missense probably benign 0.20
R0325:Cep135 UTSW 5 76615743 missense probably damaging 0.98
R0336:Cep135 UTSW 5 76601502 missense probably benign 0.07
R0564:Cep135 UTSW 5 76615710 missense probably damaging 1.00
R0564:Cep135 UTSW 5 76638949 missense probably benign 0.03
R0600:Cep135 UTSW 5 76621305 missense probably benign
R0636:Cep135 UTSW 5 76615657 missense probably benign 0.07
R0704:Cep135 UTSW 5 76630949 missense possibly damaging 0.62
R0835:Cep135 UTSW 5 76615706 missense probably benign 0.40
R1015:Cep135 UTSW 5 76640997 critical splice donor site probably null
R1167:Cep135 UTSW 5 76624637 missense probably damaging 1.00
R1252:Cep135 UTSW 5 76594115 missense possibly damaging 0.67
R1554:Cep135 UTSW 5 76634213 nonsense probably null
R1770:Cep135 UTSW 5 76603195 missense possibly damaging 0.95
R1804:Cep135 UTSW 5 76636932 missense probably benign 0.22
R1968:Cep135 UTSW 5 76624747 missense possibly damaging 0.96
R1987:Cep135 UTSW 5 76597428 missense probably benign 0.00
R2004:Cep135 UTSW 5 76632329 critical splice donor site probably null
R2178:Cep135 UTSW 5 76631450 missense probably benign 0.00
R2305:Cep135 UTSW 5 76595389 splice site probably benign
R2679:Cep135 UTSW 5 76624660 missense probably benign
R3125:Cep135 UTSW 5 76621363 critical splice donor site probably null
R3623:Cep135 UTSW 5 76624739 missense probably benign 0.00
R4359:Cep135 UTSW 5 76611714 missense possibly damaging 0.47
R4407:Cep135 UTSW 5 76624667 missense probably benign
R4561:Cep135 UTSW 5 76638193 missense possibly damaging 0.95
R4666:Cep135 UTSW 5 76616854 missense probably benign
R4945:Cep135 UTSW 5 76597428 missense probably benign 0.00
R5105:Cep135 UTSW 5 76594092 missense probably benign 0.00
R5117:Cep135 UTSW 5 76631429 missense probably benign 0.01
R5176:Cep135 UTSW 5 76637026 missense probably benign 0.04
R5194:Cep135 UTSW 5 76615777 missense probably benign 0.05
R5233:Cep135 UTSW 5 76591843 small deletion probably benign
R5275:Cep135 UTSW 5 76593204 missense possibly damaging 0.94
R5295:Cep135 UTSW 5 76593204 missense possibly damaging 0.94
R5412:Cep135 UTSW 5 76616862 missense probably benign 0.00
R5427:Cep135 UTSW 5 76638202 missense probably benign 0.00
R5801:Cep135 UTSW 5 76630676 missense probably damaging 1.00
R5975:Cep135 UTSW 5 76640890 missense possibly damaging 0.94
R6087:Cep135 UTSW 5 76615791 critical splice donor site probably null
R6176:Cep135 UTSW 5 76624643 missense probably benign
R6210:Cep135 UTSW 5 76624723 missense probably benign 0.15
R6456:Cep135 UTSW 5 76591724 start gained probably benign
R6467:Cep135 UTSW 5 76621340 missense possibly damaging 0.50
R6622:Cep135 UTSW 5 76640968 missense probably benign 0.00
R6650:Cep135 UTSW 5 76633701 missense possibly damaging 0.77
R6838:Cep135 UTSW 5 76632215 missense probably damaging 1.00
R7028:Cep135 UTSW 5 76616848 missense probably benign
R7049:Cep135 UTSW 5 76606738 missense probably benign 0.01
R7095:Cep135 UTSW 5 76594058 missense probably benign 0.10
R7207:Cep135 UTSW 5 76632243 missense probably benign 0.00
R7330:Cep135 UTSW 5 76606745 nonsense probably null
R7369:Cep135 UTSW 5 76593253 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCATGCGCCTACTGAGACTG -3'
(R):5'- GAGAACTACCTTGGCTGATGC -3'

Sequencing Primer
(F):5'- ATGCGCCTACTGAGACTGTACAG -3'
(R):5'- TGATGCCGACAGACAGCATTC -3'
Posted On2014-08-25