Incidental Mutation 'R1996:Tyw1'
ID225734
Institutional Source Beutler Lab
Gene Symbol Tyw1
Ensembl Gene ENSMUSG00000056310
Gene NametRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
SynonymsRsafd1
MMRRC Submission 040006-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1996 (G1)
Quality Score200
Status Validated
Chromosome5
Chromosomal Location130255619-130341563 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 130262811 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040213] [ENSMUST00000044204] [ENSMUST00000100662] [ENSMUST00000147619]
Predicted Effect probably benign
Transcript: ENSMUST00000040213
SMART Domains Protein: ENSMUSP00000037173
Gene: ENSMUSG00000056310

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.6e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
Pfam:Radical_SAM 399 581 1.1e-29 PFAM
Pfam:Wyosine_form 583 646 3.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044204
SMART Domains Protein: ENSMUSP00000047318
Gene: ENSMUSG00000056310

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.5e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100662
SMART Domains Protein: ENSMUSP00000098226
Gene: ENSMUSG00000056310

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 4.9e-28 PFAM
low complexity region 276 288 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147619
SMART Domains Protein: ENSMUSP00000123693
Gene: ENSMUSG00000056310

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 50 201 4.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173375
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Wybutosine (yW) is a hypermodified guanosine found in phenylalanine tRNA adjacent to the anticodon that stabilizes codon-anticodon interactions in the ribosome. In yeast, the homolog of this gene is essential for the synthesis of wybutosine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,669,597 W1069R probably damaging Het
Aaas C T 15: 102,340,059 V241I probably benign Het
Abca3 A G 17: 24,387,532 E787G probably damaging Het
Abi3bp A T 16: 56,671,357 E582D possibly damaging Het
Adam21 A G 12: 81,559,602 M462T possibly damaging Het
Alox12e T C 11: 70,316,208 T591A probably benign Het
Ankmy2 T C 12: 36,193,797 M337T probably benign Het
Antxrl A G 14: 34,075,829 N587S probably benign Het
Apol6 T A 15: 77,050,756 I75N probably benign Het
Atad2b A T 12: 4,990,883 H184L probably benign Het
Atf6b A T 17: 34,652,987 probably null Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B3gnt4 G A 5: 123,511,339 V256I probably damaging Het
BC034090 C T 1: 155,221,594 probably benign Het
Bend4 C A 5: 67,400,184 V430F probably damaging Het
Camkv A G 9: 107,947,121 D244G probably damaging Het
Caps2 T A 10: 112,204,003 L450Q probably damaging Het
Ccr1 T A 9: 123,963,514 K326N probably benign Het
Cep135 T C 5: 76,632,266 I815T probably benign Het
Chchd4 A G 6: 91,465,134 Y101H probably damaging Het
Copb1 G C 7: 114,232,203 A570G probably benign Het
Cpsf2 C A 12: 101,998,608 T505K probably benign Het
Cwf19l2 A G 9: 3,417,947 R136G probably benign Het
Daxx A G 17: 33,913,611 T572A possibly damaging Het
Etaa1 C A 11: 17,952,671 D89Y probably damaging Het
Fchsd2 T C 7: 101,278,453 F701L probably benign Het
Fstl5 A T 3: 76,707,834 H734L probably benign Het
Gabbr1 T A 17: 37,069,220 W584R probably damaging Het
Galc T C 12: 98,252,026 D189G probably damaging Het
Gm4778 A T 3: 94,265,711 M9L probably benign Het
Gm9979 T C 13: 40,705,752 noncoding transcript Het
Grin2b T C 6: 136,044,211 S31G possibly damaging Het
Gtf2ird1 T C 5: 134,376,886 probably benign Het
Hoxc4 T C 15: 103,035,757 I187T probably damaging Het
Hsd3b6 A T 3: 98,806,281 I234N probably damaging Het
Ifit3b T C 19: 34,611,477 C18R probably damaging Het
Igdcc4 T A 9: 65,121,819 V246E probably damaging Het
Il1rap A T 16: 26,722,493 T495S probably benign Het
Kctd19 T C 8: 105,395,300 E205G probably null Het
Kif21a A T 15: 90,994,371 C235* probably null Het
Krt16 A T 11: 100,248,788 S35T unknown Het
Lamc2 T C 1: 153,154,470 D142G possibly damaging Het
Larp4 G T 15: 99,984,963 W22L probably damaging Het
Ldlrad1 C T 4: 107,214,961 R127* probably null Het
Mamdc2 G A 19: 23,363,925 Q229* probably null Het
Mbtd1 CT CTT 11: 93,932,396 probably null Het
Msln T A 17: 25,754,219 M1L possibly damaging Het
Mtch2 T C 2: 90,847,321 V8A possibly damaging Het
Nav3 A T 10: 109,853,401 N338K probably damaging Het
Olfr248 T C 1: 174,391,417 M116T probably damaging Het
Olfr33 A G 7: 102,713,792 L207P probably damaging Het
Olfr774 C A 10: 129,238,429 N93K possibly damaging Het
Otof A G 5: 30,421,037 V89A probably benign Het
Phka2 T C X: 160,541,415 I255T probably benign Het
Pias2 T C 18: 77,129,063 probably null Het
Pja2 T A 17: 64,287,644 probably null Het
Plxnb2 C T 15: 89,158,768 V1473I probably benign Het
Pnpt1 T A 11: 29,141,679 D363E probably benign Het
Prdm5 A G 6: 65,936,088 Y207C probably damaging Het
Rexo5 T A 7: 119,823,857 V304E probably damaging Het
Robo1 G T 16: 72,970,179 R413L probably benign Het
Rsf1 G A 7: 97,664,632 E864K probably damaging Het
Scap C T 9: 110,372,971 probably benign Het
Scn8a T A 15: 101,024,379 M1311K probably damaging Het
Slc28a2 A T 2: 122,455,562 I460F probably damaging Het
Smco1 A G 16: 32,273,912 R134G probably benign Het
Sspo A G 6: 48,475,490 E2651G possibly damaging Het
Stab2 T C 10: 87,003,031 N57S probably damaging Het
Tenm3 C A 8: 48,228,668 Q2642H probably damaging Het
Thsd7b G T 1: 129,758,451 E577* probably null Het
Tlr3 A G 8: 45,397,697 V721A probably benign Het
Tnik A G 3: 28,665,680 I1226V probably damaging Het
Traf3 A G 12: 111,260,661 K328E probably benign Het
Vmn1r213 T G 13: 23,012,303 V352G probably benign Het
Vmn2r111 T C 17: 22,548,081 I812V probably benign Het
Vmn2r26 A G 6: 124,061,185 N573S probably damaging Het
Vmn2r45 G A 7: 8,472,025 T668I probably damaging Het
Zbtb20 T A 16: 43,610,080 V318E probably damaging Het
Zc2hc1c A G 12: 85,296,660 R524G probably benign Het
Zc3h18 C G 8: 122,407,387 probably benign Het
Zfp618 T C 4: 63,131,215 probably null Het
Other mutations in Tyw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02329:Tyw1 APN 5 130267080 missense probably benign 0.20
IGL02873:Tyw1 APN 5 130335330 missense probably benign 0.00
IGL02879:Tyw1 APN 5 130296771 missense probably damaging 1.00
IGL03080:Tyw1 APN 5 130267055 missense probably damaging 1.00
IGL03291:Tyw1 APN 5 130299993 missense probably damaging 1.00
IGL03297:Tyw1 APN 5 130340734 missense probably damaging 1.00
R1420:Tyw1 UTSW 5 130274745 critical splice donor site probably null
R1650:Tyw1 UTSW 5 130288911 missense possibly damaging 0.91
R1674:Tyw1 UTSW 5 130269328 missense probably benign 0.01
R1789:Tyw1 UTSW 5 130258993 missense probably damaging 0.99
R2421:Tyw1 UTSW 5 130269260 missense probably damaging 1.00
R3913:Tyw1 UTSW 5 130259035 missense probably damaging 0.98
R4412:Tyw1 UTSW 5 130335232 splice site probably null
R4835:Tyw1 UTSW 5 130277058 missense probably benign
R5058:Tyw1 UTSW 5 130277086 missense probably benign 0.03
R5190:Tyw1 UTSW 5 130267915 nonsense probably null
R5398:Tyw1 UTSW 5 130277157 intron probably benign
R5459:Tyw1 UTSW 5 130274706 missense probably damaging 1.00
R5597:Tyw1 UTSW 5 130274657 missense probably benign 0.00
R5704:Tyw1 UTSW 5 130282022 nonsense probably null
R5825:Tyw1 UTSW 5 130268088 missense probably damaging 0.99
R5887:Tyw1 UTSW 5 130325699 missense probably damaging 1.00
R6072:Tyw1 UTSW 5 130267911 missense possibly damaging 0.92
R6349:Tyw1 UTSW 5 130277031 missense possibly damaging 0.82
R6366:Tyw1 UTSW 5 130281951 unclassified probably benign
R7012:Tyw1 UTSW 5 130277730 splice site probably null
R7259:Tyw1 UTSW 5 130267872 splice site probably null
R7328:Tyw1 UTSW 5 130262844 missense probably benign 0.08
R7555:Tyw1 UTSW 5 130274706 missense probably damaging 1.00
R8006:Tyw1 UTSW 5 130268072 missense possibly damaging 0.87
R8171:Tyw1 UTSW 5 130300014 missense probably benign 0.19
R8196:Tyw1 UTSW 5 130300021 missense probably damaging 1.00
R8714:Tyw1 UTSW 5 130269224 missense probably damaging 1.00
R8715:Tyw1 UTSW 5 130269224 missense probably damaging 1.00
R8716:Tyw1 UTSW 5 130269224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTTTTGAGGACCCAGTTAG -3'
(R):5'- AACTGCTAAAGAGGGTTGCTGG -3'

Sequencing Primer
(F):5'- TTAGGCTGAGAGGATGAGCTG -3'
(R):5'- GCTGGCATTTCCTTTAAACACTGG -3'
Posted On2014-08-25