Incidental Mutation 'R1996:Tenm3'
ID 225750
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Name teneurin transmembrane protein 3
Synonyms Odz3, Ten-m3, 2610100B16Rik
MMRRC Submission 040006-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.584) question?
Stock # R1996 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 48680717-49296986 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 48681703 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 2642 (Q2642H)
Ref Sequence ENSEMBL: ENSMUSP00000033965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000190840]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000033965
AA Change: Q2642H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: Q2642H

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190840
AA Change: Q2626H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: Q2626H

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Meta Mutation Damage Score 0.1254 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,646,556 (GRCm39) W1069R probably damaging Het
Aaas C T 15: 102,248,494 (GRCm39) V241I probably benign Het
Abca3 A G 17: 24,606,506 (GRCm39) E787G probably damaging Het
Abi3bp A T 16: 56,491,720 (GRCm39) E582D possibly damaging Het
Adam21 A G 12: 81,606,376 (GRCm39) M462T possibly damaging Het
Alox12e T C 11: 70,207,034 (GRCm39) T591A probably benign Het
Ankmy2 T C 12: 36,243,796 (GRCm39) M337T probably benign Het
Antxrl A G 14: 33,797,786 (GRCm39) N587S probably benign Het
Apol6 T A 15: 76,934,956 (GRCm39) I75N probably benign Het
Atad2b A T 12: 5,040,883 (GRCm39) H184L probably benign Het
Atf6b A T 17: 34,871,961 (GRCm39) probably null Het
B3gnt4 G A 5: 123,649,402 (GRCm39) V256I probably damaging Het
BC034090 C T 1: 155,097,340 (GRCm39) probably benign Het
Bend4 C A 5: 67,557,527 (GRCm39) V430F probably damaging Het
Camkv A G 9: 107,824,320 (GRCm39) D244G probably damaging Het
Caps2 T A 10: 112,039,908 (GRCm39) L450Q probably damaging Het
Ccr1 T A 9: 123,763,551 (GRCm39) K326N probably benign Het
Cep135 T C 5: 76,780,113 (GRCm39) I815T probably benign Het
Chchd4 A G 6: 91,442,116 (GRCm39) Y101H probably damaging Het
Copb1 G C 7: 113,831,438 (GRCm39) A570G probably benign Het
Cpsf2 C A 12: 101,964,867 (GRCm39) T505K probably benign Het
Cwf19l2 A G 9: 3,417,947 (GRCm39) R136G probably benign Het
Daxx A G 17: 34,132,585 (GRCm39) T572A possibly damaging Het
Etaa1 C A 11: 17,902,671 (GRCm39) D89Y probably damaging Het
Ezhip GTCATCATCATCATC GTCATCATCATCATCATC X: 5,994,645 (GRCm39) probably benign Het
Fchsd2 T C 7: 100,927,660 (GRCm39) F701L probably benign Het
Fstl5 A T 3: 76,615,141 (GRCm39) H734L probably benign Het
Gabbr1 T A 17: 37,380,112 (GRCm39) W584R probably damaging Het
Galc T C 12: 98,218,285 (GRCm39) D189G probably damaging Het
Gm9979 T C 13: 40,859,228 (GRCm39) noncoding transcript Het
Grin2b T C 6: 136,021,209 (GRCm39) S31G possibly damaging Het
Gtf2ird1 T C 5: 134,405,740 (GRCm39) probably benign Het
Hoxc4 T C 15: 102,944,183 (GRCm39) I187T probably damaging Het
Hsd3b6 A T 3: 98,713,597 (GRCm39) I234N probably damaging Het
Ifit3b T C 19: 34,588,877 (GRCm39) C18R probably damaging Het
Igdcc4 T A 9: 65,029,101 (GRCm39) V246E probably damaging Het
Il1rap A T 16: 26,541,243 (GRCm39) T495S probably benign Het
Kctd19 T C 8: 106,121,932 (GRCm39) E205G probably null Het
Kif21a A T 15: 90,878,574 (GRCm39) C235* probably null Het
Krt16 A T 11: 100,139,614 (GRCm39) S35T unknown Het
Lamc2 T C 1: 153,030,216 (GRCm39) D142G possibly damaging Het
Larp4 G T 15: 99,882,844 (GRCm39) W22L probably damaging Het
Ldlrad1 C T 4: 107,072,158 (GRCm39) R127* probably null Het
Mamdc2 G A 19: 23,341,289 (GRCm39) Q229* probably null Het
Mbtd1 CT CTT 11: 93,823,222 (GRCm39) probably null Het
Msln T A 17: 25,973,193 (GRCm39) M1L possibly damaging Het
Mtch2 T C 2: 90,677,665 (GRCm39) V8A possibly damaging Het
Nav3 A T 10: 109,689,262 (GRCm39) N338K probably damaging Het
Or10x4 T C 1: 174,218,983 (GRCm39) M116T probably damaging Het
Or51a39 A G 7: 102,362,999 (GRCm39) L207P probably damaging Het
Or6c5 C A 10: 129,074,298 (GRCm39) N93K possibly damaging Het
Otof A G 5: 30,578,381 (GRCm39) V89A probably benign Het
Phka2 T C X: 159,324,411 (GRCm39) I255T probably benign Het
Pias2 T C 18: 77,216,759 (GRCm39) probably null Het
Pja2 T A 17: 64,594,639 (GRCm39) probably null Het
Plxnb2 C T 15: 89,042,971 (GRCm39) V1473I probably benign Het
Pnpt1 T A 11: 29,091,679 (GRCm39) D363E probably benign Het
Prdm5 A G 6: 65,913,072 (GRCm39) Y207C probably damaging Het
Rexo5 T A 7: 119,423,080 (GRCm39) V304E probably damaging Het
Robo1 G T 16: 72,767,067 (GRCm39) R413L probably benign Het
Rsf1 G A 7: 97,313,839 (GRCm39) E864K probably damaging Het
Scap C T 9: 110,202,039 (GRCm39) probably benign Het
Scn8a T A 15: 100,922,260 (GRCm39) M1311K probably damaging Het
Slc28a2 A T 2: 122,286,043 (GRCm39) I460F probably damaging Het
Smco1 A G 16: 32,092,730 (GRCm39) R134G probably benign Het
Spopfm1 A T 3: 94,173,018 (GRCm39) M9L probably benign Het
Sspo A G 6: 48,452,424 (GRCm39) E2651G possibly damaging Het
Stab2 T C 10: 86,838,895 (GRCm39) N57S probably damaging Het
Thsd7b G T 1: 129,686,188 (GRCm39) E577* probably null Het
Tlr3 A G 8: 45,850,734 (GRCm39) V721A probably benign Het
Tnik A G 3: 28,719,829 (GRCm39) I1226V probably damaging Het
Traf3 A G 12: 111,227,095 (GRCm39) K328E probably benign Het
Tyw1 T A 5: 130,291,652 (GRCm39) probably benign Het
Vmn1r213 T G 13: 23,196,473 (GRCm39) V352G probably benign Het
Vmn2r111 T C 17: 22,767,062 (GRCm39) I812V probably benign Het
Vmn2r26 A G 6: 124,038,144 (GRCm39) N573S probably damaging Het
Vmn2r45 G A 7: 8,475,024 (GRCm39) T668I probably damaging Het
Zbtb20 T A 16: 43,430,443 (GRCm39) V318E probably damaging Het
Zc2hc1c A G 12: 85,343,434 (GRCm39) R524G probably benign Het
Zc3h18 C G 8: 123,134,126 (GRCm39) probably benign Het
Zfp618 T C 4: 63,049,452 (GRCm39) probably null Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48,870,095 (GRCm39) missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48,689,060 (GRCm39) missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48,732,077 (GRCm39) missense probably benign 0.39
IGL00720:Tenm3 APN 8 48,729,456 (GRCm39) missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48,870,167 (GRCm39) missense probably benign 0.00
IGL00976:Tenm3 APN 8 48,709,876 (GRCm39) missense probably benign 0.14
IGL01469:Tenm3 APN 8 48,689,458 (GRCm39) missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48,729,680 (GRCm39) missense probably benign 0.09
IGL01590:Tenm3 APN 8 48,681,837 (GRCm39) missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48,707,512 (GRCm39) missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48,689,793 (GRCm39) nonsense probably null
IGL01892:Tenm3 APN 8 48,729,431 (GRCm39) missense probably benign 0.09
IGL02098:Tenm3 APN 8 48,729,611 (GRCm39) missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48,688,511 (GRCm39) missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48,689,729 (GRCm39) missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48,732,233 (GRCm39) splice site probably benign
IGL02502:Tenm3 APN 8 48,741,051 (GRCm39) missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48,752,674 (GRCm39) missense probably benign 0.30
IGL02543:Tenm3 APN 8 48,751,991 (GRCm39) missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48,729,938 (GRCm39) missense probably benign 0.02
IGL03037:Tenm3 APN 8 48,751,913 (GRCm39) missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 49,099,453 (GRCm39) missense probably benign 0.05
IGL03268:Tenm3 APN 8 48,688,558 (GRCm39) missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48,688,381 (GRCm39) missense probably damaging 0.99
PIT4431001:Tenm3 UTSW 8 48,688,642 (GRCm39) missense probably damaging 1.00
PIT4504001:Tenm3 UTSW 8 48,746,692 (GRCm39) missense probably damaging 1.00
R0079:Tenm3 UTSW 8 48,796,380 (GRCm39) missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48,795,694 (GRCm39) missense probably damaging 0.99
R0123:Tenm3 UTSW 8 49,127,507 (GRCm39) missense probably damaging 1.00
R0134:Tenm3 UTSW 8 49,127,507 (GRCm39) missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48,689,755 (GRCm39) missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48,689,755 (GRCm39) missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48,794,069 (GRCm39) missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48,689,947 (GRCm39) splice site probably benign
R0335:Tenm3 UTSW 8 48,685,140 (GRCm39) missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48,682,010 (GRCm39) missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48,740,826 (GRCm39) missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48,794,195 (GRCm39) splice site probably benign
R0573:Tenm3 UTSW 8 49,127,434 (GRCm39) splice site probably benign
R0599:Tenm3 UTSW 8 48,730,745 (GRCm39) missense probably damaging 1.00
R0616:Tenm3 UTSW 8 48,729,191 (GRCm39) missense possibly damaging 0.76
R0637:Tenm3 UTSW 8 48,689,560 (GRCm39) missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48,689,629 (GRCm39) missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48,788,777 (GRCm39) missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48,752,000 (GRCm39) missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48,681,577 (GRCm39) missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48,688,617 (GRCm39) missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48,693,431 (GRCm39) missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48,740,928 (GRCm39) missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48,729,435 (GRCm39) missense probably benign
R1455:Tenm3 UTSW 8 48,732,083 (GRCm39) missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48,689,006 (GRCm39) missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48,763,660 (GRCm39) missense probably damaging 1.00
R1501:Tenm3 UTSW 8 48,796,351 (GRCm39) missense probably damaging 0.99
R1507:Tenm3 UTSW 8 48,740,857 (GRCm39) missense probably benign 0.01
R1522:Tenm3 UTSW 8 48,848,611 (GRCm39) missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48,682,016 (GRCm39) missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48,689,456 (GRCm39) missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48,682,028 (GRCm39) missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48,732,109 (GRCm39) missense probably benign 0.09
R1676:Tenm3 UTSW 8 48,870,154 (GRCm39) missense possibly damaging 0.83
R1732:Tenm3 UTSW 8 48,763,669 (GRCm39) missense probably damaging 1.00
R1768:Tenm3 UTSW 8 48,685,139 (GRCm39) missense probably damaging 1.00
R1777:Tenm3 UTSW 8 48,870,214 (GRCm39) missense probably benign 0.05
R1793:Tenm3 UTSW 8 49,127,579 (GRCm39) missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48,729,291 (GRCm39) missense probably benign 0.39
R1863:Tenm3 UTSW 8 48,729,381 (GRCm39) missense probably benign 0.20
R1898:Tenm3 UTSW 8 48,763,796 (GRCm39) missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48,689,348 (GRCm39) missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48,681,626 (GRCm39) missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48,795,291 (GRCm39) critical splice donor site probably null
R2109:Tenm3 UTSW 8 48,796,384 (GRCm39) missense possibly damaging 0.94
R2124:Tenm3 UTSW 8 48,870,041 (GRCm39) critical splice donor site probably null
R2190:Tenm3 UTSW 8 48,848,579 (GRCm39) missense probably damaging 1.00
R2204:Tenm3 UTSW 8 49,127,585 (GRCm39) missense probably benign 0.17
R2233:Tenm3 UTSW 8 48,729,204 (GRCm39) missense probably benign 0.04
R2234:Tenm3 UTSW 8 48,729,204 (GRCm39) missense probably benign 0.04
R2235:Tenm3 UTSW 8 48,729,204 (GRCm39) missense probably benign 0.04
R2237:Tenm3 UTSW 8 48,795,372 (GRCm39) missense probably damaging 1.00
R2418:Tenm3 UTSW 8 48,729,693 (GRCm39) missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48,729,693 (GRCm39) missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48,740,988 (GRCm39) missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48,693,305 (GRCm39) missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48,681,590 (GRCm39) missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48,730,781 (GRCm39) missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48,802,258 (GRCm39) missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48,802,439 (GRCm39) missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48,848,693 (GRCm39) missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48,746,761 (GRCm39) missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48,689,005 (GRCm39) missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48,766,271 (GRCm39) critical splice donor site probably null
R4851:Tenm3 UTSW 8 48,763,656 (GRCm39) critical splice donor site probably null
R4867:Tenm3 UTSW 8 48,688,856 (GRCm39) missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48,729,896 (GRCm39) missense probably damaging 0.99
R4895:Tenm3 UTSW 8 48,754,006 (GRCm39) missense probably damaging 1.00
R4962:Tenm3 UTSW 8 48,731,996 (GRCm39) nonsense probably null
R4995:Tenm3 UTSW 8 48,682,172 (GRCm39) missense possibly damaging 0.87
R4996:Tenm3 UTSW 8 48,688,861 (GRCm39) missense probably damaging 0.97
R5091:Tenm3 UTSW 8 48,795,343 (GRCm39) missense probably benign 0.14
R5228:Tenm3 UTSW 8 48,689,390 (GRCm39) missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48,682,233 (GRCm39) missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48,689,890 (GRCm39) missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48,740,866 (GRCm39) missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48,689,390 (GRCm39) missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48,689,599 (GRCm39) missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48,820,412 (GRCm39) nonsense probably null
R5566:Tenm3 UTSW 8 48,732,041 (GRCm39) missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48,689,799 (GRCm39) missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48,681,797 (GRCm39) missense probably damaging 1.00
R5931:Tenm3 UTSW 8 49,099,533 (GRCm39) missense probably benign 0.00
R5959:Tenm3 UTSW 8 49,099,482 (GRCm39) nonsense probably null
R5965:Tenm3 UTSW 8 48,681,543 (GRCm39) nonsense probably null
R6062:Tenm3 UTSW 8 48,796,441 (GRCm39) missense possibly damaging 0.46
R6151:Tenm3 UTSW 8 48,848,608 (GRCm39) missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48,751,843 (GRCm39) missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48,707,657 (GRCm39) missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48,746,700 (GRCm39) missense probably damaging 0.99
R6233:Tenm3 UTSW 8 48,870,094 (GRCm39) missense probably damaging 1.00
R6270:Tenm3 UTSW 8 48,820,429 (GRCm39) missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48,729,884 (GRCm39) missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48,689,098 (GRCm39) missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48,870,257 (GRCm39) missense probably benign
R6516:Tenm3 UTSW 8 48,870,257 (GRCm39) missense probably benign
R6747:Tenm3 UTSW 8 48,796,278 (GRCm39) missense probably damaging 1.00
R6782:Tenm3 UTSW 8 49,099,291 (GRCm39) critical splice donor site probably null
R6788:Tenm3 UTSW 8 49,127,528 (GRCm39) missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48,709,872 (GRCm39) missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48,729,773 (GRCm39) missense probably benign 0.39
R6913:Tenm3 UTSW 8 48,751,972 (GRCm39) missense probably damaging 0.99
R6941:Tenm3 UTSW 8 49,127,451 (GRCm39) missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48,693,514 (GRCm39) nonsense probably null
R6968:Tenm3 UTSW 8 48,689,474 (GRCm39) missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48,689,474 (GRCm39) missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48,689,474 (GRCm39) missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48,693,479 (GRCm39) missense probably damaging 1.00
R7125:Tenm3 UTSW 8 49,127,588 (GRCm39) missense probably benign 0.00
R7140:Tenm3 UTSW 8 48,745,271 (GRCm39) missense probably damaging 1.00
R7222:Tenm3 UTSW 8 48,754,004 (GRCm39) missense probably damaging 1.00
R7232:Tenm3 UTSW 8 48,688,970 (GRCm39) missense probably damaging 1.00
R7336:Tenm3 UTSW 8 48,689,212 (GRCm39) missense possibly damaging 0.93
R7417:Tenm3 UTSW 8 48,689,218 (GRCm39) missense probably damaging 1.00
R7526:Tenm3 UTSW 8 48,740,847 (GRCm39) missense probably damaging 0.96
R7527:Tenm3 UTSW 8 48,729,635 (GRCm39) missense possibly damaging 0.60
R7616:Tenm3 UTSW 8 48,794,084 (GRCm39) missense possibly damaging 0.56
R7662:Tenm3 UTSW 8 48,788,762 (GRCm39) missense probably benign 0.27
R7734:Tenm3 UTSW 8 49,099,368 (GRCm39) missense probably damaging 1.00
R7802:Tenm3 UTSW 8 48,689,500 (GRCm39) missense probably damaging 1.00
R7812:Tenm3 UTSW 8 48,729,335 (GRCm39) missense probably benign 0.01
R7843:Tenm3 UTSW 8 48,682,146 (GRCm39) nonsense probably null
R7951:Tenm3 UTSW 8 48,763,738 (GRCm39) missense possibly damaging 0.86
R8293:Tenm3 UTSW 8 48,820,457 (GRCm39) missense possibly damaging 0.91
R8336:Tenm3 UTSW 8 48,746,808 (GRCm39) missense probably damaging 1.00
R8351:Tenm3 UTSW 8 48,740,907 (GRCm39) missense probably damaging 0.96
R8387:Tenm3 UTSW 8 48,740,883 (GRCm39) missense probably damaging 0.98
R8414:Tenm3 UTSW 8 48,746,544 (GRCm39) missense probably damaging 1.00
R8451:Tenm3 UTSW 8 48,740,907 (GRCm39) missense probably damaging 0.96
R8465:Tenm3 UTSW 8 48,682,216 (GRCm39) missense probably damaging 1.00
R8528:Tenm3 UTSW 8 48,795,668 (GRCm39) missense probably damaging 1.00
R8717:Tenm3 UTSW 8 48,752,680 (GRCm39) missense possibly damaging 0.77
R8734:Tenm3 UTSW 8 48,802,391 (GRCm39) missense probably benign 0.16
R8781:Tenm3 UTSW 8 48,795,484 (GRCm39) frame shift probably null
R8820:Tenm3 UTSW 8 48,763,759 (GRCm39) missense probably damaging 0.96
R8821:Tenm3 UTSW 8 48,729,417 (GRCm39) missense
R8831:Tenm3 UTSW 8 48,729,417 (GRCm39) missense
R8853:Tenm3 UTSW 8 48,795,382 (GRCm39) missense probably damaging 1.00
R8900:Tenm3 UTSW 8 48,689,437 (GRCm39) missense probably damaging 1.00
R8931:Tenm3 UTSW 8 48,688,637 (GRCm39) missense probably damaging 1.00
R8933:Tenm3 UTSW 8 48,732,095 (GRCm39) missense possibly damaging 0.53
R8989:Tenm3 UTSW 8 48,688,383 (GRCm39) nonsense probably null
R8998:Tenm3 UTSW 8 48,729,722 (GRCm39) missense probably damaging 1.00
R9008:Tenm3 UTSW 8 48,795,688 (GRCm39) missense probably damaging 0.98
R9017:Tenm3 UTSW 8 48,707,668 (GRCm39) missense probably damaging 0.99
R9101:Tenm3 UTSW 8 48,745,186 (GRCm39) missense probably damaging 1.00
R9108:Tenm3 UTSW 8 48,766,271 (GRCm39) critical splice donor site probably null
R9142:Tenm3 UTSW 8 48,788,548 (GRCm39) missense unknown
R9231:Tenm3 UTSW 8 48,689,231 (GRCm39) missense probably damaging 1.00
R9309:Tenm3 UTSW 8 48,751,972 (GRCm39) missense probably damaging 0.99
R9310:Tenm3 UTSW 8 49,008,935 (GRCm39) unclassified probably benign
R9336:Tenm3 UTSW 8 48,870,115 (GRCm39) missense probably damaging 1.00
R9373:Tenm3 UTSW 8 48,752,690 (GRCm39) missense probably damaging 1.00
R9393:Tenm3 UTSW 8 49,127,559 (GRCm39) missense probably damaging 0.99
R9509:Tenm3 UTSW 8 48,766,292 (GRCm39) nonsense probably null
R9575:Tenm3 UTSW 8 48,688,796 (GRCm39) missense possibly damaging 0.94
R9698:Tenm3 UTSW 8 48,689,246 (GRCm39) missense probably damaging 1.00
R9722:Tenm3 UTSW 8 48,753,849 (GRCm39) missense probably benign 0.00
R9788:Tenm3 UTSW 8 48,788,596 (GRCm39) missense probably benign 0.02
X0010:Tenm3 UTSW 8 48,740,864 (GRCm39) missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48,689,512 (GRCm39) missense probably damaging 1.00
Z1177:Tenm3 UTSW 8 48,729,815 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTTGTTGGCACTGTCAGC -3'
(R):5'- ACTTCACCATCGAGGGCAAG -3'

Sequencing Primer
(F):5'- GCACTGTCAGCCAGCTC -3'
(R):5'- CCATCGAGGGCAAGGACAC -3'
Posted On 2014-08-25