Incidental Mutation 'R1996:Nav3'
ID225760
Institutional Source Beutler Lab
Gene Symbol Nav3
Ensembl Gene ENSMUSG00000020181
Gene Nameneuron navigator 3
SynonymsPOMFIL1, 9630020C08Rik, 4732483H20Rik, unc53H3, steerin 3, Pomfil1p
MMRRC Submission 040006-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1996 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location109681259-110456204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109853401 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 338 (N338K)
Ref Sequence ENSEMBL: ENSMUSP00000032719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032719]
Predicted Effect probably damaging
Transcript: ENSMUST00000032719
AA Change: N338K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032719
Gene: ENSMUSG00000020181
AA Change: N338K

DomainStartEndE-ValueType
CH 79 182 4.41e-12 SMART
low complexity region 184 194 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 353 363 N/A INTRINSIC
low complexity region 427 439 N/A INTRINSIC
low complexity region 522 536 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 904 916 N/A INTRINSIC
low complexity region 1077 1095 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1207 1229 N/A INTRINSIC
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1274 1285 N/A INTRINSIC
low complexity region 1293 1312 N/A INTRINSIC
low complexity region 1327 1341 N/A INTRINSIC
low complexity region 1383 1397 N/A INTRINSIC
low complexity region 1462 1474 N/A INTRINSIC
low complexity region 1550 1563 N/A INTRINSIC
coiled coil region 1565 1656 N/A INTRINSIC
low complexity region 1675 1692 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
low complexity region 1756 1781 N/A INTRINSIC
low complexity region 1782 1795 N/A INTRINSIC
coiled coil region 1801 1842 N/A INTRINSIC
low complexity region 1848 1871 N/A INTRINSIC
AAA 2029 2184 4.94e-7 SMART
Meta Mutation Damage Score 0.0635 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,669,597 W1069R probably damaging Het
Aaas C T 15: 102,340,059 V241I probably benign Het
Abca3 A G 17: 24,387,532 E787G probably damaging Het
Abi3bp A T 16: 56,671,357 E582D possibly damaging Het
Adam21 A G 12: 81,559,602 M462T possibly damaging Het
Alox12e T C 11: 70,316,208 T591A probably benign Het
Ankmy2 T C 12: 36,193,797 M337T probably benign Het
Antxrl A G 14: 34,075,829 N587S probably benign Het
Apol6 T A 15: 77,050,756 I75N probably benign Het
Atad2b A T 12: 4,990,883 H184L probably benign Het
Atf6b A T 17: 34,652,987 probably null Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B3gnt4 G A 5: 123,511,339 V256I probably damaging Het
BC034090 C T 1: 155,221,594 probably benign Het
Bend4 C A 5: 67,400,184 V430F probably damaging Het
Camkv A G 9: 107,947,121 D244G probably damaging Het
Caps2 T A 10: 112,204,003 L450Q probably damaging Het
Ccr1 T A 9: 123,963,514 K326N probably benign Het
Cep135 T C 5: 76,632,266 I815T probably benign Het
Chchd4 A G 6: 91,465,134 Y101H probably damaging Het
Copb1 G C 7: 114,232,203 A570G probably benign Het
Cpsf2 C A 12: 101,998,608 T505K probably benign Het
Cwf19l2 A G 9: 3,417,947 R136G probably benign Het
Daxx A G 17: 33,913,611 T572A possibly damaging Het
Etaa1 C A 11: 17,952,671 D89Y probably damaging Het
Fchsd2 T C 7: 101,278,453 F701L probably benign Het
Fstl5 A T 3: 76,707,834 H734L probably benign Het
Gabbr1 T A 17: 37,069,220 W584R probably damaging Het
Galc T C 12: 98,252,026 D189G probably damaging Het
Gm4778 A T 3: 94,265,711 M9L probably benign Het
Gm9979 T C 13: 40,705,752 noncoding transcript Het
Grin2b T C 6: 136,044,211 S31G possibly damaging Het
Gtf2ird1 T C 5: 134,376,886 probably benign Het
Hoxc4 T C 15: 103,035,757 I187T probably damaging Het
Hsd3b6 A T 3: 98,806,281 I234N probably damaging Het
Ifit3b T C 19: 34,611,477 C18R probably damaging Het
Igdcc4 T A 9: 65,121,819 V246E probably damaging Het
Il1rap A T 16: 26,722,493 T495S probably benign Het
Kctd19 T C 8: 105,395,300 E205G probably null Het
Kif21a A T 15: 90,994,371 C235* probably null Het
Krt16 A T 11: 100,248,788 S35T unknown Het
Lamc2 T C 1: 153,154,470 D142G possibly damaging Het
Larp4 G T 15: 99,984,963 W22L probably damaging Het
Ldlrad1 C T 4: 107,214,961 R127* probably null Het
Mamdc2 G A 19: 23,363,925 Q229* probably null Het
Mbtd1 CT CTT 11: 93,932,396 probably null Het
Msln T A 17: 25,754,219 M1L possibly damaging Het
Mtch2 T C 2: 90,847,321 V8A possibly damaging Het
Olfr248 T C 1: 174,391,417 M116T probably damaging Het
Olfr33 A G 7: 102,713,792 L207P probably damaging Het
Olfr774 C A 10: 129,238,429 N93K possibly damaging Het
Otof A G 5: 30,421,037 V89A probably benign Het
Phka2 T C X: 160,541,415 I255T probably benign Het
Pias2 T C 18: 77,129,063 probably null Het
Pja2 T A 17: 64,287,644 probably null Het
Plxnb2 C T 15: 89,158,768 V1473I probably benign Het
Pnpt1 T A 11: 29,141,679 D363E probably benign Het
Prdm5 A G 6: 65,936,088 Y207C probably damaging Het
Rexo5 T A 7: 119,823,857 V304E probably damaging Het
Robo1 G T 16: 72,970,179 R413L probably benign Het
Rsf1 G A 7: 97,664,632 E864K probably damaging Het
Scap C T 9: 110,372,971 probably benign Het
Scn8a T A 15: 101,024,379 M1311K probably damaging Het
Slc28a2 A T 2: 122,455,562 I460F probably damaging Het
Smco1 A G 16: 32,273,912 R134G probably benign Het
Sspo A G 6: 48,475,490 E2651G possibly damaging Het
Stab2 T C 10: 87,003,031 N57S probably damaging Het
Tenm3 C A 8: 48,228,668 Q2642H probably damaging Het
Thsd7b G T 1: 129,758,451 E577* probably null Het
Tlr3 A G 8: 45,397,697 V721A probably benign Het
Tnik A G 3: 28,665,680 I1226V probably damaging Het
Traf3 A G 12: 111,260,661 K328E probably benign Het
Tyw1 T A 5: 130,262,811 probably benign Het
Vmn1r213 T G 13: 23,012,303 V352G probably benign Het
Vmn2r111 T C 17: 22,548,081 I812V probably benign Het
Vmn2r26 A G 6: 124,061,185 N573S probably damaging Het
Vmn2r45 G A 7: 8,472,025 T668I probably damaging Het
Zbtb20 T A 16: 43,610,080 V318E probably damaging Het
Zc2hc1c A G 12: 85,296,660 R524G probably benign Het
Zc3h18 C G 8: 122,407,387 probably benign Het
Zfp618 T C 4: 63,131,215 probably null Het
Other mutations in Nav3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Nav3 APN 10 109841733 missense probably damaging 0.99
IGL00425:Nav3 APN 10 109703507 missense probably benign 0.13
IGL00465:Nav3 APN 10 109852746 missense probably damaging 0.99
IGL00531:Nav3 APN 10 109703310 missense probably null 0.99
IGL00575:Nav3 APN 10 109764765 missense probably damaging 0.98
IGL00770:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00774:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00858:Nav3 APN 10 109742632 missense probably damaging 0.98
IGL00935:Nav3 APN 10 109705666 missense probably benign
IGL01638:Nav3 APN 10 109852863 missense probably damaging 1.00
IGL01662:Nav3 APN 10 109769258 missense possibly damaging 0.56
IGL01670:Nav3 APN 10 109714241 missense possibly damaging 0.92
IGL01885:Nav3 APN 10 109742660 nonsense probably null
IGL01979:Nav3 APN 10 109704929 missense probably benign 0.01
IGL02121:Nav3 APN 10 109759036 missense probably damaging 0.99
IGL02210:Nav3 APN 10 109766990 missense probably benign
IGL02523:Nav3 APN 10 109769296 missense probably damaging 1.00
IGL02573:Nav3 APN 10 109866974 missense probably benign 0.23
IGL02633:Nav3 APN 10 109692136 missense probably benign 0.09
IGL02810:Nav3 APN 10 109816274 missense probably damaging 1.00
IGL02964:Nav3 APN 10 109736953 missense probably damaging 0.99
IGL03015:Nav3 APN 10 109718297 missense probably damaging 0.98
IGL03288:Nav3 APN 10 109759017 missense probably damaging 1.00
IGL03310:Nav3 APN 10 109824572 critical splice donor site probably null
PIT4377001:Nav3 UTSW 10 109716605 missense probably damaging 0.99
R0010:Nav3 UTSW 10 109823226 splice site probably benign
R0043:Nav3 UTSW 10 109767518 missense possibly damaging 0.95
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0077:Nav3 UTSW 10 109716642 missense possibly damaging 0.87
R0219:Nav3 UTSW 10 109866930 critical splice donor site probably null
R0310:Nav3 UTSW 10 109767128 missense possibly damaging 0.82
R0380:Nav3 UTSW 10 109758879 splice site probably benign
R0403:Nav3 UTSW 10 109767103 missense probably damaging 0.98
R0480:Nav3 UTSW 10 109853300 missense probably damaging 1.00
R0626:Nav3 UTSW 10 109823464 missense probably damaging 1.00
R0637:Nav3 UTSW 10 109770197 missense probably benign 0.25
R0847:Nav3 UTSW 10 109903857 missense possibly damaging 0.94
R0988:Nav3 UTSW 10 109716528 missense probably damaging 1.00
R1272:Nav3 UTSW 10 109736999 missense probably damaging 0.98
R1295:Nav3 UTSW 10 109692102 missense probably damaging 1.00
R1405:Nav3 UTSW 10 109770333 splice site probably benign
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1420:Nav3 UTSW 10 109823254 missense probably benign 0.02
R1449:Nav3 UTSW 10 109853511 missense probably benign 0.13
R1458:Nav3 UTSW 10 109720044 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1472:Nav3 UTSW 10 109727941 missense probably damaging 0.99
R1537:Nav3 UTSW 10 109866985 missense probably damaging 1.00
R1539:Nav3 UTSW 10 109767170 missense probably damaging 0.99
R1581:Nav3 UTSW 10 109823428 missense probably damaging 1.00
R1586:Nav3 UTSW 10 109853254 missense probably damaging 1.00
R1654:Nav3 UTSW 10 109853123 missense possibly damaging 0.85
R1725:Nav3 UTSW 10 109823590 missense probably damaging 1.00
R1742:Nav3 UTSW 10 109769213 missense probably benign
R1793:Nav3 UTSW 10 109703372 missense probably benign 0.00
R1830:Nav3 UTSW 10 109823323 missense probably damaging 1.00
R1834:Nav3 UTSW 10 109720022 missense probably damaging 0.99
R1881:Nav3 UTSW 10 109852559 missense probably damaging 0.96
R1922:Nav3 UTSW 10 109705606 missense probably benign 0.43
R1944:Nav3 UTSW 10 109716530 missense probably damaging 0.99
R1981:Nav3 UTSW 10 109719090 splice site probably benign
R1985:Nav3 UTSW 10 109770184 splice site probably benign
R2051:Nav3 UTSW 10 109824675 missense probably damaging 0.99
R2062:Nav3 UTSW 10 109720021 missense probably damaging 1.00
R2139:Nav3 UTSW 10 109853135 missense probably benign 0.22
R2248:Nav3 UTSW 10 109696227 missense probably damaging 1.00
R2420:Nav3 UTSW 10 109863813 missense probably damaging 0.98
R2444:Nav3 UTSW 10 109764915 missense probably benign 0.09
R3026:Nav3 UTSW 10 109824604 missense probably damaging 0.99
R3052:Nav3 UTSW 10 109903752 missense probably damaging 0.99
R3441:Nav3 UTSW 10 109704928 missense probably benign 0.01
R3845:Nav3 UTSW 10 109853376 missense possibly damaging 0.82
R3929:Nav3 UTSW 10 109684203 missense probably damaging 1.00
R3932:Nav3 UTSW 10 109694035 missense probably damaging 0.99
R4056:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4057:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4120:Nav3 UTSW 10 109903744 critical splice donor site probably null
R4244:Nav3 UTSW 10 109769296 missense probably damaging 1.00
R4361:Nav3 UTSW 10 109852986 missense probably damaging 1.00
R4512:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4514:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4700:Nav3 UTSW 10 109764935 missense probably benign 0.10
R4815:Nav3 UTSW 10 109823552 missense probably benign
R4981:Nav3 UTSW 10 109880692 missense probably benign
R5042:Nav3 UTSW 10 109769268 missense probably benign 0.27
R5251:Nav3 UTSW 10 109853253 missense probably damaging 0.99
R5252:Nav3 UTSW 10 109714291 small deletion probably benign
R5273:Nav3 UTSW 10 109693038 critical splice donor site probably null
R5288:Nav3 UTSW 10 109853105 missense probably benign 0.10
R5407:Nav3 UTSW 10 109866935 missense probably benign 0.28
R5533:Nav3 UTSW 10 109883678 missense possibly damaging 0.61
R5561:Nav3 UTSW 10 109716552 missense probably damaging 1.00
R5577:Nav3 UTSW 10 109769403 missense probably damaging 1.00
R5656:Nav3 UTSW 10 109764633 missense probably damaging 0.96
R5872:Nav3 UTSW 10 109764787 missense probably damaging 1.00
R6023:Nav3 UTSW 10 109823515 missense possibly damaging 0.95
R6061:Nav3 UTSW 10 109866984 nonsense probably null
R6189:Nav3 UTSW 10 109720019 missense probably damaging 0.98
R6214:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6215:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6264:Nav3 UTSW 10 109688833 missense probably damaging 0.97
R6500:Nav3 UTSW 10 109764756 missense probably damaging 1.00
R6524:Nav3 UTSW 10 109720030 missense probably damaging 0.99
R6868:Nav3 UTSW 10 109693166 missense possibly damaging 0.49
R7079:Nav3 UTSW 10 109767292 missense probably benign 0.16
R7099:Nav3 UTSW 10 109703334 missense probably benign 0.11
R7139:Nav3 UTSW 10 109853477 missense probably benign 0.44
R7238:Nav3 UTSW 10 109853324 missense possibly damaging 0.75
R7338:Nav3 UTSW 10 109769212 missense probably benign 0.04
R7343:Nav3 UTSW 10 109903758 missense probably damaging 0.98
R7383:Nav3 UTSW 10 109716671 missense probably damaging 0.98
R7391:Nav3 UTSW 10 109703456 missense probably benign 0.07
R7399:Nav3 UTSW 10 109852934 missense possibly damaging 0.74
R7457:Nav3 UTSW 10 109696328 nonsense probably null
R7462:Nav3 UTSW 10 109823578 missense probably damaging 1.00
R7542:Nav3 UTSW 10 109823533 missense possibly damaging 0.89
R7659:Nav3 UTSW 10 109766990 missense probably benign 0.09
R7749:Nav3 UTSW 10 109703352 missense probably damaging 0.99
R7794:Nav3 UTSW 10 109688856 missense probably benign 0.08
R7876:Nav3 UTSW 10 109853498 missense probably benign 0.26
R7959:Nav3 UTSW 10 109853498 missense probably benign 0.26
R8048:Nav3 UTSW 10 109764918 missense not run
X0012:Nav3 UTSW 10 109692097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAACTGGGAGCCTGAGG -3'
(R):5'- AGTGCAATGGTGATTTATAAATGAGT -3'

Sequencing Primer
(F):5'- GGCGTAGTGCTGTCCGG -3'
(R):5'- ATGTGCAGATTCCCCCAA -3'
Posted On2014-08-25