Incidental Mutation 'R1996:Zbtb20'
ID225789
Institutional Source Beutler Lab
Gene Symbol Zbtb20
Ensembl Gene ENSMUSG00000022708
Gene Namezinc finger and BTB domain containing 20
SynonymsZfp288, D16Wsu73e, 7330412A13Rik, 1300017A20Rik, HOF, A930017C21Rik
MMRRC Submission 040006-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1996 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location42875881-43642602 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43610080 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 318 (V318E)
Ref Sequence ENSEMBL: ENSMUSP00000110343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079441] [ENSMUST00000114690] [ENSMUST00000114691] [ENSMUST00000114694] [ENSMUST00000114695] [ENSMUST00000146708] [ENSMUST00000148775] [ENSMUST00000156367] [ENSMUST00000156981]
Predicted Effect probably damaging
Transcript: ENSMUST00000079441
AA Change: V318E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078410
Gene: ENSMUSG00000022708
AA Change: V318E

DomainStartEndE-ValueType
BTB 104 197 2.04e-21 SMART
low complexity region 403 423 N/A INTRINSIC
ZnF_C2H2 578 600 6.88e-4 SMART
ZnF_C2H2 606 628 4.17e-3 SMART
ZnF_C2H2 634 656 7.6e-6 SMART
ZnF_C2H2 662 684 5.06e-2 SMART
low complexity region 689 708 N/A INTRINSIC
ZnF_C2H2 715 737 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114690
AA Change: V245E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110338
Gene: ENSMUSG00000022708
AA Change: V245E

DomainStartEndE-ValueType
BTB 31 124 2.04e-21 SMART
low complexity region 330 350 N/A INTRINSIC
ZnF_C2H2 505 527 6.88e-4 SMART
ZnF_C2H2 533 555 4.17e-3 SMART
ZnF_C2H2 561 583 7.6e-6 SMART
ZnF_C2H2 589 611 5.06e-2 SMART
low complexity region 616 635 N/A INTRINSIC
ZnF_C2H2 642 664 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114691
AA Change: V245E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110339
Gene: ENSMUSG00000022708
AA Change: V245E

DomainStartEndE-ValueType
BTB 31 124 2.04e-21 SMART
low complexity region 330 350 N/A INTRINSIC
ZnF_C2H2 505 527 6.88e-4 SMART
ZnF_C2H2 533 555 4.17e-3 SMART
ZnF_C2H2 561 583 7.6e-6 SMART
ZnF_C2H2 589 611 5.06e-2 SMART
low complexity region 616 635 N/A INTRINSIC
ZnF_C2H2 642 664 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114694
AA Change: V318E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110342
Gene: ENSMUSG00000022708
AA Change: V318E

DomainStartEndE-ValueType
BTB 104 197 2.04e-21 SMART
low complexity region 403 423 N/A INTRINSIC
ZnF_C2H2 578 600 6.88e-4 SMART
ZnF_C2H2 606 628 4.17e-3 SMART
ZnF_C2H2 634 656 7.6e-6 SMART
ZnF_C2H2 662 684 5.06e-2 SMART
low complexity region 689 708 N/A INTRINSIC
ZnF_C2H2 715 737 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114695
AA Change: V318E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110343
Gene: ENSMUSG00000022708
AA Change: V318E

DomainStartEndE-ValueType
BTB 104 197 2.04e-21 SMART
low complexity region 403 423 N/A INTRINSIC
ZnF_C2H2 578 600 6.88e-4 SMART
ZnF_C2H2 606 628 4.17e-3 SMART
ZnF_C2H2 634 656 7.6e-6 SMART
ZnF_C2H2 662 684 5.06e-2 SMART
low complexity region 689 708 N/A INTRINSIC
ZnF_C2H2 715 737 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146708
SMART Domains Protein: ENSMUSP00000125233
Gene: ENSMUSG00000022708

DomainStartEndE-ValueType
Pfam:BTB 21 74 3.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148775
SMART Domains Protein: ENSMUSP00000125016
Gene: ENSMUSG00000022708

DomainStartEndE-ValueType
Pfam:BTB 21 60 9.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156367
SMART Domains Protein: ENSMUSP00000124126
Gene: ENSMUSG00000022708

DomainStartEndE-ValueType
Pfam:BTB 94 131 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156981
SMART Domains Protein: ENSMUSP00000124189
Gene: ENSMUSG00000022708

DomainStartEndE-ValueType
BTB 31 124 2.04e-21 SMART
Meta Mutation Damage Score 0.6596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which was initially designated as dendritic cell-derived BTB/POZ zinc finger (DPZF), belongs to a family of transcription factors with an N-terminal BTB/POZ domain and a C-terminal DNA-bindng zinc finger domain. The BTB/POZ domain is a hydrophobic region of approximately 120 aa which mediates association with other BTB/POZ domain-containing proteins. This gene acts as a transcriptional repressor and plays a role in many processes including neurogenesis, glucose homeostasis, and postnatal growth. Mutations in this gene have been associated with Primrose syndrome as well as the 3q13.31 microdeletion syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, disrupted homeostasis, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,669,597 W1069R probably damaging Het
Aaas C T 15: 102,340,059 V241I probably benign Het
Abca3 A G 17: 24,387,532 E787G probably damaging Het
Abi3bp A T 16: 56,671,357 E582D possibly damaging Het
Adam21 A G 12: 81,559,602 M462T possibly damaging Het
Alox12e T C 11: 70,316,208 T591A probably benign Het
Ankmy2 T C 12: 36,193,797 M337T probably benign Het
Antxrl A G 14: 34,075,829 N587S probably benign Het
Apol6 T A 15: 77,050,756 I75N probably benign Het
Atad2b A T 12: 4,990,883 H184L probably benign Het
Atf6b A T 17: 34,652,987 probably null Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B3gnt4 G A 5: 123,511,339 V256I probably damaging Het
BC034090 C T 1: 155,221,594 probably benign Het
Bend4 C A 5: 67,400,184 V430F probably damaging Het
Camkv A G 9: 107,947,121 D244G probably damaging Het
Caps2 T A 10: 112,204,003 L450Q probably damaging Het
Ccr1 T A 9: 123,963,514 K326N probably benign Het
Cep135 T C 5: 76,632,266 I815T probably benign Het
Chchd4 A G 6: 91,465,134 Y101H probably damaging Het
Copb1 G C 7: 114,232,203 A570G probably benign Het
Cpsf2 C A 12: 101,998,608 T505K probably benign Het
Cwf19l2 A G 9: 3,417,947 R136G probably benign Het
Daxx A G 17: 33,913,611 T572A possibly damaging Het
Etaa1 C A 11: 17,952,671 D89Y probably damaging Het
Fchsd2 T C 7: 101,278,453 F701L probably benign Het
Fstl5 A T 3: 76,707,834 H734L probably benign Het
Gabbr1 T A 17: 37,069,220 W584R probably damaging Het
Galc T C 12: 98,252,026 D189G probably damaging Het
Gm4778 A T 3: 94,265,711 M9L probably benign Het
Gm9979 T C 13: 40,705,752 noncoding transcript Het
Grin2b T C 6: 136,044,211 S31G possibly damaging Het
Gtf2ird1 T C 5: 134,376,886 probably benign Het
Hoxc4 T C 15: 103,035,757 I187T probably damaging Het
Hsd3b6 A T 3: 98,806,281 I234N probably damaging Het
Ifit3b T C 19: 34,611,477 C18R probably damaging Het
Igdcc4 T A 9: 65,121,819 V246E probably damaging Het
Il1rap A T 16: 26,722,493 T495S probably benign Het
Kctd19 T C 8: 105,395,300 E205G probably null Het
Kif21a A T 15: 90,994,371 C235* probably null Het
Krt16 A T 11: 100,248,788 S35T unknown Het
Lamc2 T C 1: 153,154,470 D142G possibly damaging Het
Larp4 G T 15: 99,984,963 W22L probably damaging Het
Ldlrad1 C T 4: 107,214,961 R127* probably null Het
Mamdc2 G A 19: 23,363,925 Q229* probably null Het
Mbtd1 CT CTT 11: 93,932,396 probably null Het
Msln T A 17: 25,754,219 M1L possibly damaging Het
Mtch2 T C 2: 90,847,321 V8A possibly damaging Het
Nav3 A T 10: 109,853,401 N338K probably damaging Het
Olfr248 T C 1: 174,391,417 M116T probably damaging Het
Olfr33 A G 7: 102,713,792 L207P probably damaging Het
Olfr774 C A 10: 129,238,429 N93K possibly damaging Het
Otof A G 5: 30,421,037 V89A probably benign Het
Phka2 T C X: 160,541,415 I255T probably benign Het
Pias2 T C 18: 77,129,063 probably null Het
Pja2 T A 17: 64,287,644 probably null Het
Plxnb2 C T 15: 89,158,768 V1473I probably benign Het
Pnpt1 T A 11: 29,141,679 D363E probably benign Het
Prdm5 A G 6: 65,936,088 Y207C probably damaging Het
Rexo5 T A 7: 119,823,857 V304E probably damaging Het
Robo1 G T 16: 72,970,179 R413L probably benign Het
Rsf1 G A 7: 97,664,632 E864K probably damaging Het
Scap C T 9: 110,372,971 probably benign Het
Scn8a T A 15: 101,024,379 M1311K probably damaging Het
Slc28a2 A T 2: 122,455,562 I460F probably damaging Het
Smco1 A G 16: 32,273,912 R134G probably benign Het
Sspo A G 6: 48,475,490 E2651G possibly damaging Het
Stab2 T C 10: 87,003,031 N57S probably damaging Het
Tenm3 C A 8: 48,228,668 Q2642H probably damaging Het
Thsd7b G T 1: 129,758,451 E577* probably null Het
Tlr3 A G 8: 45,397,697 V721A probably benign Het
Tnik A G 3: 28,665,680 I1226V probably damaging Het
Traf3 A G 12: 111,260,661 K328E probably benign Het
Tyw1 T A 5: 130,262,811 probably benign Het
Vmn1r213 T G 13: 23,012,303 V352G probably benign Het
Vmn2r111 T C 17: 22,548,081 I812V probably benign Het
Vmn2r26 A G 6: 124,061,185 N573S probably damaging Het
Vmn2r45 G A 7: 8,472,025 T668I probably damaging Het
Zc2hc1c A G 12: 85,296,660 R524G probably benign Het
Zc3h18 C G 8: 122,407,387 probably benign Het
Zfp618 T C 4: 63,131,215 probably null Het
Other mutations in Zbtb20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Zbtb20 APN 16 43610661 missense possibly damaging 0.85
IGL02170:Zbtb20 APN 16 43609662 missense possibly damaging 0.84
IGL02292:Zbtb20 APN 16 43610648 nonsense probably null
IGL02733:Zbtb20 APN 16 43609933 missense possibly damaging 0.48
IGL03277:Zbtb20 APN 16 43618437 missense possibly damaging 0.95
siberian UTSW 16 43610676 missense probably damaging 0.96
Tiger UTSW 16 43618398 missense probably damaging 0.98
Towering UTSW 16 43610867 nonsense probably null
R0310:Zbtb20 UTSW 16 43609746 missense probably damaging 0.98
R1593:Zbtb20 UTSW 16 43609423 missense probably damaging 0.99
R2018:Zbtb20 UTSW 16 43577652 missense possibly damaging 0.86
R2050:Zbtb20 UTSW 16 43609612 unclassified probably null
R2097:Zbtb20 UTSW 16 43609519 missense probably null 1.00
R4006:Zbtb20 UTSW 16 43609399 missense probably damaging 1.00
R4708:Zbtb20 UTSW 16 43610676 missense probably damaging 0.96
R4710:Zbtb20 UTSW 16 43610676 missense probably damaging 0.96
R4835:Zbtb20 UTSW 16 43618398 missense probably damaging 0.98
R4962:Zbtb20 UTSW 16 43618692 missense probably damaging 0.99
R5531:Zbtb20 UTSW 16 43610867 nonsense probably null
R7452:Zbtb20 UTSW 16 43610676 missense probably damaging 0.96
R7523:Zbtb20 UTSW 16 43610512 missense probably benign 0.01
Z1176:Zbtb20 UTSW 16 43610530 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CTTCTACAGTGGTGCAGTGG -3'
(R):5'- AACTGTTGCTCCACTGAGTC -3'

Sequencing Primer
(F):5'- ACAGTGGTGCAGTGGTCAGC -3'
(R):5'- TGCTCCACTGAGTCAGGTTCG -3'
Posted On2014-08-25