Mutagenetix > Incidental Mutations

Incidental Mutation 'R2000:Cd46'

225809

Institutional Source

Beutler Lab

Gene Symbol

Cd46

Ensembl Gene

ENSMUSG00000016493

Gene Name

CD46 antigen, complement regulatory protein

Synonyms

CD46, Mcp

MMRRC Submission

040010-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2000 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

195036826-195092249 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 195077704 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 280 (I280T)

Ref Sequence

ENSEMBL: ENSMUSP00000123901 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159563] [ENSMUST00000162650]

Predicted Effect

probably benign
Transcript: ENSMUST00000159563
AA Change: I280T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000123901
Gene: ENSMUSG00000016493
AA Change: I280T

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
CCP	45	104	6.7e-3	SMART
CCP	109	168	3.87e-8	SMART
CCP	173	234	2.14e-10	SMART
CCP	239	294	1.06e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162650
AA Change: I280T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000123931
Gene: ENSMUSG00000016493
AA Change: I280T

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
CCP	45	104	6.7e-3	SMART
CCP	109	168	3.87e-8	SMART
CCP	173	234	2.14e-10	SMART
CCP	239	294	1.06e-14	SMART
transmembrane domain	328	350	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162951

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195553

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein and is a regulatory part of the complement system. The encoded protein has cofactor activity for inactivation of complement components C3b and C4b by serum factor I, which protects the host cell from damage by complement. In addition, the encoded protein can act as a receptor for the Edmonston strain of measles virus, human herpesvirus-6, and type IV pili of pathogenic Neisseria. Finally, the protein encoded by this gene may be involved in the fusion of the spermatozoa with the oocyte during fertilization. Mutations at this locus have been associated with susceptibility to hemolytic uremic syndrome. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutation of this gene results in increased litter sizes sired by mutant males. Another homozygous null mouse shows increased susceptibility to induced choroid neovascularization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atf2	T	C	2: 73,863,240		probably null	Het
Atrn	T	C	2: 130,935,588	Y186H	probably damaging	Het
Birc6	T	C	17: 74,604,619	V1528A	possibly damaging	Het
Brpf3	A	C	17: 28,821,557	E984A	probably benign	Het
Btnl9	T	C	11: 49,169,121	N600S	probably benign	Het
C330027C09Rik	A	T	16: 49,014,969	Q699L	probably damaging	Het
Camk1d	A	T	2: 5,362,025	Y126*	probably null	Het
Casp8ap2	T	A	4: 32,634,874	L136H	probably damaging	Het
Crebbp	A	T	16: 4,084,252	H2374Q	probably damaging	Het
Dock3	A	G	9: 106,992,961		probably benign	Het
Dph7	T	A	2: 24,971,641	D355E	probably benign	Het
Dync1li1	C	A	9: 114,713,563	F264L	probably benign	Het
Fer1l6	G	A	15: 58,602,311		probably benign	Het
Flt3	T	C	5: 147,341,238	D842G	probably damaging	Het
Fosl1	A	G	19: 5,450,355		probably benign	Het
Gabrr2	T	A	4: 33,084,400	I162N	probably damaging	Het
Gata6	T	C	18: 11,054,113	F14S	probably benign	Het
Gm10767	A	T	13: 66,908,150	N69I	possibly damaging	Het
Gm15446	T	C	5: 109,942,811	S310P	possibly damaging	Het
Gm4759	G	A	7: 106,423,231	S188L	probably benign	Het
Gmppa	A	C	1: 75,441,528	D190A	probably damaging	Het
Gpr108	C	T	17: 57,236,712	G455S	probably benign	Het
Gstm1	A	G	3: 108,014,811	F170S	probably damaging	Het
Gzf1	T	C	2: 148,684,611	I334T	probably benign	Het
Hadh	A	T	3: 131,245,239	I156K	probably benign	Het
Htr5a	G	A	5: 27,850,889	V293M	possibly damaging	Het
Ice1	C	T	13: 70,602,427	V47M	possibly damaging	Het
Ifnl3	G	T	7: 28,522,929	A32S	possibly damaging	Het
Itsn2	T	A	12: 4,666,176	Y978*	probably null	Het
Kif1a	G	T	1: 93,054,329	T792N	probably damaging	Het
Lgals9	T	C	11: 78,973,170	N50D	probably benign	Het
Lrp2	A	G	2: 69,467,090	Y3176H	probably damaging	Het
Lvrn	A	T	18: 46,905,307	N976I	probably benign	Het
Magea10	A	T	X: 72,382,773	I205K	probably benign	Het
Myo1c	A	T	11: 75,670,579	M820L	probably damaging	Het
Neb	A	T	2: 52,212,970	C4222*	probably null	Het
Nkain2	T	A	10: 32,890,285		probably benign	Het
Olfr1155	G	A	2: 87,943,146	L161F	probably benign	Het
Olfr401	A	G	11: 74,121,580	Y97C	probably benign	Het
Olfr981	A	G	9: 40,022,689	I99V	probably benign	Het
Parp4	C	T	14: 56,613,724	T728M	probably damaging	Het
Pnmal1	T	A	7: 16,961,039	V273D	probably benign	Het
Ppp1r9b	A	G	11: 94,996,620	E486G	probably damaging	Het
Pth2	C	A	7: 45,181,722	R98S	possibly damaging	Het
Rif1	T	A	2: 52,081,298	F263I	probably damaging	Het
Rnf213	A	T	11: 119,436,022	I1613F	probably damaging	Het
Rsbn1l	G	A	5: 20,902,370	H549Y	probably damaging	Het
Rtl1	C	A	12: 109,593,887	W506L	probably damaging	Het
Slc4a4	C	T	5: 89,028,347	P59L	probably damaging	Het
Smarcad1	A	G	6: 65,073,216	E273G	probably damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Ttf1	T	A	2: 29,065,185	L187Q	possibly damaging	Het
Ttn	A	T	2: 76,969,703	I387N	probably damaging	Het
Ufsp1	T	C	5: 137,294,904		probably null	Het
Uox	A	C	3: 146,610,399	K30Q	possibly damaging	Het
Ush1c	A	G	7: 46,221,433	S327P	probably damaging	Het
Wwc1	A	T	11: 35,876,547	L419Q	probably damaging	Het
Xrn1	C	T	9: 96,045,563	Q1463*	probably null	Het
Yeats2	G	A	16: 20,186,391	A393T	probably benign	Het
Zfp101	C	T	17: 33,381,517	A422T	possibly damaging	Het

Other mutations in Cd46

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02429:Cd46	APN	1	195085424	missense	probably benign	0.01
IGL03029:Cd46	APN	1	195086143	missense	probably benign	0.43
R0269:Cd46	UTSW	1	195064688	missense	probably benign	0.00
R0375:Cd46	UTSW	1	195086164	missense	probably benign	0.00
R0627:Cd46	UTSW	1	195092186	missense	probably benign	0.03
R0784:Cd46	UTSW	1	195092194	missense	possibly damaging	0.96
R0892:Cd46	UTSW	1	195082612	missense	possibly damaging	0.78
R0973:Cd46	UTSW	1	195041992	makesense	probably null
R0973:Cd46	UTSW	1	195041992	makesense	probably null
R0974:Cd46	UTSW	1	195041992	makesense	probably null
R1224:Cd46	UTSW	1	195062398	missense	possibly damaging	0.66
R1716:Cd46	UTSW	1	195077809	missense	probably benign	0.21
R1863:Cd46	UTSW	1	195083623	missense	probably damaging	1.00
R2152:Cd46	UTSW	1	195062413	missense	probably benign	0.42
R2153:Cd46	UTSW	1	195062413	missense	probably benign	0.42
R4452:Cd46	UTSW	1	195085360	missense	possibly damaging	0.84
R4860:Cd46	UTSW	1	195062396	missense	possibly damaging	0.94
R4860:Cd46	UTSW	1	195062396	missense	possibly damaging	0.94
R4934:Cd46	UTSW	1	195082799	intron	probably benign
R5156:Cd46	UTSW	1	195085385	missense	possibly damaging	0.90
R5287:Cd46	UTSW	1	195062411	missense	possibly damaging	0.65
R5303:Cd46	UTSW	1	195062399	missense	probably benign
R5403:Cd46	UTSW	1	195062411	missense	possibly damaging	0.65
R5487:Cd46	UTSW	1	195068170	critical splice acceptor site	probably null
R5505:Cd46	UTSW	1	195085380	missense	possibly damaging	0.88
R5538:Cd46	UTSW	1	195068170	critical splice acceptor site	probably null
R6721:Cd46	UTSW	1	195083631	missense	probably damaging	1.00
R6731:Cd46	UTSW	1	195083467	intron	probably null
R7226:Cd46	UTSW	1	195042006	missense	possibly damaging	0.84
R7633:Cd46	UTSW	1	195083619	missense	probably null	0.01

Predicted Primers

PCR Primer
(F):5'- CACAGGCCTGAGGTAAGTAC -3'
(R):5'- AAAATACCCTGTGTACTGGTGTAGG -3'

Sequencing Primer
(F):5'- GGCCTGAGGTAAGTACTAAATTATTG -3'
(R):5'- AGGGAGTCATGTGCTCATATATTTAG -3'

Posted On

2014-08-25