Incidental Mutation 'R2000:Cd46'
ID225809
Institutional Source Beutler Lab
Gene Symbol Cd46
Ensembl Gene ENSMUSG00000016493
Gene NameCD46 antigen, complement regulatory protein
SynonymsCD46, Mcp
MMRRC Submission 040010-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2000 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location195036826-195092249 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 195077704 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 280 (I280T)
Ref Sequence ENSEMBL: ENSMUSP00000123901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159563] [ENSMUST00000162650]
Predicted Effect probably benign
Transcript: ENSMUST00000159563
AA Change: I280T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000123901
Gene: ENSMUSG00000016493
AA Change: I280T

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
CCP 45 104 6.7e-3 SMART
CCP 109 168 3.87e-8 SMART
CCP 173 234 2.14e-10 SMART
CCP 239 294 1.06e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162650
AA Change: I280T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123931
Gene: ENSMUSG00000016493
AA Change: I280T

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
CCP 45 104 6.7e-3 SMART
CCP 109 168 3.87e-8 SMART
CCP 173 234 2.14e-10 SMART
CCP 239 294 1.06e-14 SMART
transmembrane domain 328 350 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195553
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein and is a regulatory part of the complement system. The encoded protein has cofactor activity for inactivation of complement components C3b and C4b by serum factor I, which protects the host cell from damage by complement. In addition, the encoded protein can act as a receptor for the Edmonston strain of measles virus, human herpesvirus-6, and type IV pili of pathogenic Neisseria. Finally, the protein encoded by this gene may be involved in the fusion of the spermatozoa with the oocyte during fertilization. Mutations at this locus have been associated with susceptibility to hemolytic uremic syndrome. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutation of this gene results in increased litter sizes sired by mutant males. Another homozygous null mouse shows increased susceptibility to induced choroid neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf2 T C 2: 73,863,240 probably null Het
Atrn T C 2: 130,935,588 Y186H probably damaging Het
Birc6 T C 17: 74,604,619 V1528A possibly damaging Het
Brpf3 A C 17: 28,821,557 E984A probably benign Het
Btnl9 T C 11: 49,169,121 N600S probably benign Het
C330027C09Rik A T 16: 49,014,969 Q699L probably damaging Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Casp8ap2 T A 4: 32,634,874 L136H probably damaging Het
Crebbp A T 16: 4,084,252 H2374Q probably damaging Het
Dock3 A G 9: 106,992,961 probably benign Het
Dph7 T A 2: 24,971,641 D355E probably benign Het
Dync1li1 C A 9: 114,713,563 F264L probably benign Het
Fer1l6 G A 15: 58,602,311 probably benign Het
Flt3 T C 5: 147,341,238 D842G probably damaging Het
Fosl1 A G 19: 5,450,355 probably benign Het
Gabrr2 T A 4: 33,084,400 I162N probably damaging Het
Gata6 T C 18: 11,054,113 F14S probably benign Het
Gm10767 A T 13: 66,908,150 N69I possibly damaging Het
Gm15446 T C 5: 109,942,811 S310P possibly damaging Het
Gm4759 G A 7: 106,423,231 S188L probably benign Het
Gmppa A C 1: 75,441,528 D190A probably damaging Het
Gpr108 C T 17: 57,236,712 G455S probably benign Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Gzf1 T C 2: 148,684,611 I334T probably benign Het
Hadh A T 3: 131,245,239 I156K probably benign Het
Htr5a G A 5: 27,850,889 V293M possibly damaging Het
Ice1 C T 13: 70,602,427 V47M possibly damaging Het
Ifnl3 G T 7: 28,522,929 A32S possibly damaging Het
Itsn2 T A 12: 4,666,176 Y978* probably null Het
Kif1a G T 1: 93,054,329 T792N probably damaging Het
Lgals9 T C 11: 78,973,170 N50D probably benign Het
Lrp2 A G 2: 69,467,090 Y3176H probably damaging Het
Lvrn A T 18: 46,905,307 N976I probably benign Het
Magea10 A T X: 72,382,773 I205K probably benign Het
Myo1c A T 11: 75,670,579 M820L probably damaging Het
Neb A T 2: 52,212,970 C4222* probably null Het
Nkain2 T A 10: 32,890,285 probably benign Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Olfr981 A G 9: 40,022,689 I99V probably benign Het
Parp4 C T 14: 56,613,724 T728M probably damaging Het
Pnmal1 T A 7: 16,961,039 V273D probably benign Het
Ppp1r9b A G 11: 94,996,620 E486G probably damaging Het
Pth2 C A 7: 45,181,722 R98S possibly damaging Het
Rif1 T A 2: 52,081,298 F263I probably damaging Het
Rnf213 A T 11: 119,436,022 I1613F probably damaging Het
Rsbn1l G A 5: 20,902,370 H549Y probably damaging Het
Rtl1 C A 12: 109,593,887 W506L probably damaging Het
Slc4a4 C T 5: 89,028,347 P59L probably damaging Het
Smarcad1 A G 6: 65,073,216 E273G probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Ttf1 T A 2: 29,065,185 L187Q possibly damaging Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ufsp1 T C 5: 137,294,904 probably null Het
Uox A C 3: 146,610,399 K30Q possibly damaging Het
Ush1c A G 7: 46,221,433 S327P probably damaging Het
Wwc1 A T 11: 35,876,547 L419Q probably damaging Het
Xrn1 C T 9: 96,045,563 Q1463* probably null Het
Yeats2 G A 16: 20,186,391 A393T probably benign Het
Zfp101 C T 17: 33,381,517 A422T possibly damaging Het
Other mutations in Cd46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02429:Cd46 APN 1 195085424 missense probably benign 0.01
IGL03029:Cd46 APN 1 195086143 missense probably benign 0.43
R0269:Cd46 UTSW 1 195064688 missense probably benign 0.00
R0375:Cd46 UTSW 1 195086164 missense probably benign 0.00
R0627:Cd46 UTSW 1 195092186 missense probably benign 0.03
R0784:Cd46 UTSW 1 195092194 missense possibly damaging 0.96
R0892:Cd46 UTSW 1 195082612 missense possibly damaging 0.78
R0973:Cd46 UTSW 1 195041992 makesense probably null
R0973:Cd46 UTSW 1 195041992 makesense probably null
R0974:Cd46 UTSW 1 195041992 makesense probably null
R1224:Cd46 UTSW 1 195062398 missense possibly damaging 0.66
R1716:Cd46 UTSW 1 195077809 missense probably benign 0.21
R1863:Cd46 UTSW 1 195083623 missense probably damaging 1.00
R2152:Cd46 UTSW 1 195062413 missense probably benign 0.42
R2153:Cd46 UTSW 1 195062413 missense probably benign 0.42
R4452:Cd46 UTSW 1 195085360 missense possibly damaging 0.84
R4860:Cd46 UTSW 1 195062396 missense possibly damaging 0.94
R4860:Cd46 UTSW 1 195062396 missense possibly damaging 0.94
R4934:Cd46 UTSW 1 195082799 intron probably benign
R5156:Cd46 UTSW 1 195085385 missense possibly damaging 0.90
R5287:Cd46 UTSW 1 195062411 missense possibly damaging 0.65
R5303:Cd46 UTSW 1 195062399 missense probably benign
R5403:Cd46 UTSW 1 195062411 missense possibly damaging 0.65
R5487:Cd46 UTSW 1 195068170 critical splice acceptor site probably null
R5505:Cd46 UTSW 1 195085380 missense possibly damaging 0.88
R5538:Cd46 UTSW 1 195068170 critical splice acceptor site probably null
R6721:Cd46 UTSW 1 195083631 missense probably damaging 1.00
R6731:Cd46 UTSW 1 195083467 intron probably null
R7226:Cd46 UTSW 1 195042006 missense possibly damaging 0.84
R7633:Cd46 UTSW 1 195083619 missense probably null 0.01
Predicted Primers PCR Primer
(F):5'- CACAGGCCTGAGGTAAGTAC -3'
(R):5'- AAAATACCCTGTGTACTGGTGTAGG -3'

Sequencing Primer
(F):5'- GGCCTGAGGTAAGTACTAAATTATTG -3'
(R):5'- AGGGAGTCATGTGCTCATATATTTAG -3'
Posted On2014-08-25