Incidental Mutation 'R0145:1700017N19Rik'
Institutional Source Beutler Lab
Gene Symbol 1700017N19Rik
Ensembl Gene ENSMUSG00000056912
Gene NameRIKEN cDNA 1700017N19 gene
MMRRC Submission 038430-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0145 (G1) of strain 722
Quality Score184
Status Validated (trace)
Chromosomal Location100590484-100618401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100601921 bp
Amino Acid Change Glutamic Acid to Glycine at position 64 (E64G)
Ref Sequence ENSEMBL: ENSMUSP00000140459 (fasta)
AlphaFold A0A087WPJ1
Predicted Effect probably benign
Transcript: ENSMUST00000041162
AA Change: E64G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000186825
Predicted Effect probably benign
Transcript: ENSMUST00000187119
AA Change: E64G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000188736
AA Change: E64G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably damaging
Transcript: ENSMUST00000188930
AA Change: E64G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000190386
AA Change: E64G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000190708
AA Change: E118G

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000191336
Predicted Effect probably benign
Transcript: ENSMUST00000218464
AA Change: E64G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.0919 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 93.7%
  • 20x: 82.1%
Validation Efficiency 96% (109/113)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T C 10: 77,983,556 S196P probably benign Het
4931408C20Rik A G 1: 26,687,332 M32T probably benign Het
Actr6 A T 10: 89,728,178 Y77* probably null Het
Aldoart1 A T 4: 72,851,339 S411T probably benign Het
Aqp1 C T 6: 55,346,687 R234C probably damaging Het
Arsb G A 13: 93,862,287 G368R possibly damaging Het
Asxl3 G A 18: 22,453,605 A151T probably damaging Het
Bcas3 T C 11: 85,359,610 probably benign Het
Bmpr2 AACACA AACA 1: 59,867,580 probably null Het
Bst1 A G 5: 43,819,072 Y49C probably damaging Het
Btrc T A 19: 45,423,173 L12Q probably damaging Het
Cd248 T C 19: 5,069,023 F300L possibly damaging Het
Cdk11b G T 4: 155,641,619 probably benign Het
Cfap44 A T 16: 44,468,372 D1495V probably damaging Het
Chil3 T A 3: 106,160,478 I124F probably damaging Het
Cnot2 A T 10: 116,517,368 S63T possibly damaging Het
Cox8a G T 19: 7,215,418 H61N probably benign Het
Cpne9 T C 6: 113,300,601 V427A probably damaging Het
Ctsll3 C A 13: 60,798,595 G301C probably damaging Het
Cubn T A 2: 13,306,432 D3094V probably damaging Het
Cyba A T 8: 122,427,238 M65K possibly damaging Het
Cyp4f39 T A 17: 32,486,960 S342T possibly damaging Het
Daam2 T C 17: 49,480,778 I436V probably benign Het
Daglb T C 5: 143,474,608 probably benign Het
Dnah7b T G 1: 46,223,178 L2067R probably damaging Het
Ep300 T C 15: 81,616,127 probably null Het
Esm1 A G 13: 113,216,696 N171D probably damaging Het
Fbxl2 T C 9: 113,985,325 E266G probably damaging Het
Ficd G T 5: 113,738,819 A352S probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Hacd3 A T 9: 65,004,242 probably benign Het
Kbtbd6 T A 14: 79,453,024 N386K probably benign Het
Lct T C 1: 128,327,895 M137V probably benign Het
Lilr4b T G 10: 51,484,518 N176K probably benign Het
Macf1 T A 4: 123,387,397 H4340L probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mmrn1 C A 6: 60,973,010 Q315K probably damaging Het
Mon2 C A 10: 123,013,512 L1294F possibly damaging Het
Muc5ac A G 7: 141,795,275 T483A possibly damaging Het
Nacc1 T C 8: 84,674,875 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ngef A G 1: 87,540,648 probably benign Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Ogfod3 A T 11: 121,195,070 probably benign Het
Olfr1104 A C 2: 87,021,790 Y251* probably null Het
Olfr767 A T 10: 129,079,363 V200E probably damaging Het
Parpbp T C 10: 88,093,009 Y523C possibly damaging Het
Pik3cg C A 12: 32,204,322 L555F probably benign Het
Pkp3 T G 7: 141,089,763 probably null Het
Pole G T 5: 110,324,425 R1518L probably damaging Het
Prkab1 T C 5: 116,018,085 probably benign Het
Prrc2a T C 17: 35,155,820 T1285A probably benign Het
Pus1 C A 5: 110,774,854 V222L probably benign Het
Rab11fip1 A G 8: 27,143,324 L1118P probably damaging Het
Ranbp2 T A 10: 58,480,046 I2196N probably damaging Het
Rims3 T C 4: 120,887,026 L151P probably damaging Het
Rnf130 A G 11: 50,071,219 D164G possibly damaging Het
Rps6ka2 C A 17: 7,262,186 L293I probably benign Het
Ruvbl1 A G 6: 88,484,459 T269A possibly damaging Het
Sema4a A T 3: 88,451,422 I10N probably damaging Het
Serpinb6e A T 13: 33,841,060 S83T probably benign Het
Slc12a9 C A 5: 137,315,288 W803L probably damaging Het
Slc3a2 A G 19: 8,708,073 S188P probably damaging Het
Slc7a13 G A 4: 19,818,782 probably benign Het
Spg20 A T 3: 55,127,671 K493* probably null Het
Sun1 T C 5: 139,241,411 V574A probably damaging Het
Supt6 A G 11: 78,208,236 V1603A probably benign Het
Tgm5 A G 2: 121,077,581 V38A possibly damaging Het
Tm6sf2 T C 8: 70,077,868 probably benign Het
Tnfaip2 T A 12: 111,445,858 V231E possibly damaging Het
Tube1 T A 10: 39,145,602 M281K possibly damaging Het
Tubgcp3 A G 8: 12,657,561 Y143H probably benign Het
Tyrp1 A G 4: 80,840,778 Y296C probably damaging Het
Utp4 A G 8: 106,894,669 N26S probably benign Het
Vgf T A 5: 137,031,482 probably benign Het
Zfat T C 15: 68,187,099 K196E possibly damaging Het
Zfp366 G T 13: 99,229,540 S403I probably damaging Het
Zfp462 G A 4: 55,010,529 G832R probably damaging Het
Zfp955a T A 17: 33,242,456 Q234L probably damaging Het
Zufsp T C 10: 33,943,713 T202A probably damaging Het
Other mutations in 1700017N19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01565:1700017N19Rik APN 10 100603360 missense probably damaging 1.00
IGL02159:1700017N19Rik APN 10 100610665 missense probably damaging 1.00
IGL02556:1700017N19Rik APN 10 100610717 critical splice donor site probably null
IGL02629:1700017N19Rik APN 10 100609144 splice site probably benign
IGL02692:1700017N19Rik APN 10 100603548 missense probably benign 0.05
IGL02962:1700017N19Rik APN 10 100610593 splice site probably null
R0402:1700017N19Rik UTSW 10 100609253 missense probably damaging 0.99
R1514:1700017N19Rik UTSW 10 100612867 missense probably damaging 1.00
R1519:1700017N19Rik UTSW 10 100603528 missense probably damaging 0.98
R1680:1700017N19Rik UTSW 10 100603528 missense probably damaging 0.98
R1686:1700017N19Rik UTSW 10 100612860 missense probably damaging 0.97
R3951:1700017N19Rik UTSW 10 100615296 splice site probably benign
R3952:1700017N19Rik UTSW 10 100615296 splice site probably benign
R4423:1700017N19Rik UTSW 10 100605633 missense probably damaging 0.99
R4905:1700017N19Rik UTSW 10 100612818 splice site probably null
R5507:1700017N19Rik UTSW 10 100609233 missense probably benign 0.02
R5898:1700017N19Rik UTSW 10 100612900 missense possibly damaging 0.56
R5898:1700017N19Rik UTSW 10 100615208 missense probably benign 0.20
R5977:1700017N19Rik UTSW 10 100615244 missense probably damaging 0.99
R7034:1700017N19Rik UTSW 10 100609256 critical splice donor site probably null
R7036:1700017N19Rik UTSW 10 100609256 critical splice donor site probably null
R7394:1700017N19Rik UTSW 10 100609176 missense probably benign 0.01
R7412:1700017N19Rik UTSW 10 100612829 nonsense probably null
R7870:1700017N19Rik UTSW 10 100605643 missense probably benign
R7914:1700017N19Rik UTSW 10 100592676 missense probably benign
R8466:1700017N19Rik UTSW 10 100602011 missense probably benign 0.00
R8558:1700017N19Rik UTSW 10 100594635 missense probably benign 0.23
R9105:1700017N19Rik UTSW 10 100603545 nonsense probably null
Z1088:1700017N19Rik UTSW 10 100605639 missense probably damaging 1.00
Z1176:1700017N19Rik UTSW 10 100612429 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agcccctattcttgccatac -3'
Posted On2013-04-16