Incidental Mutation 'R2000:Ttf1'
ID225812
Institutional Source Beutler Lab
Gene Symbol Ttf1
Ensembl Gene ENSMUSG00000026803
Gene Nametranscription termination factor, RNA polymerase I
Synonyms
MMRRC Submission 040010-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R2000 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location29060262-29087656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29065185 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 187 (L187Q)
Ref Sequence ENSEMBL: ENSMUSP00000097809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100237]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100237
AA Change: L187Q

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097809
Gene: ENSMUSG00000026803
AA Change: L187Q

DomainStartEndE-ValueType
internal_repeat_1 13 67 1.04e-14 PROSPERO
internal_repeat_1 85 142 1.04e-14 PROSPERO
low complexity region 143 153 N/A INTRINSIC
low complexity region 171 183 N/A INTRINSIC
low complexity region 274 293 N/A INTRINSIC
low complexity region 350 387 N/A INTRINSIC
low complexity region 434 447 N/A INTRINSIC
low complexity region 451 461 N/A INTRINSIC
Blast:SANT 508 585 8e-28 BLAST
SANT 589 636 2.37e-6 SMART
SANT 638 720 1.8e-6 SMART
low complexity region 805 819 N/A INTRINSIC
low complexity region 842 857 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142786
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf2 T C 2: 73,863,240 probably null Het
Atrn T C 2: 130,935,588 Y186H probably damaging Het
Birc6 T C 17: 74,604,619 V1528A possibly damaging Het
Brpf3 A C 17: 28,821,557 E984A probably benign Het
Btnl9 T C 11: 49,169,121 N600S probably benign Het
C330027C09Rik A T 16: 49,014,969 Q699L probably damaging Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Casp8ap2 T A 4: 32,634,874 L136H probably damaging Het
Cd46 A G 1: 195,077,704 I280T probably benign Het
Crebbp A T 16: 4,084,252 H2374Q probably damaging Het
Dock3 A G 9: 106,992,961 probably benign Het
Dph7 T A 2: 24,971,641 D355E probably benign Het
Dync1li1 C A 9: 114,713,563 F264L probably benign Het
Fer1l6 G A 15: 58,602,311 probably benign Het
Flt3 T C 5: 147,341,238 D842G probably damaging Het
Fosl1 A G 19: 5,450,355 probably benign Het
Gabrr2 T A 4: 33,084,400 I162N probably damaging Het
Gata6 T C 18: 11,054,113 F14S probably benign Het
Gm10767 A T 13: 66,908,150 N69I possibly damaging Het
Gm15446 T C 5: 109,942,811 S310P possibly damaging Het
Gm4759 G A 7: 106,423,231 S188L probably benign Het
Gmppa A C 1: 75,441,528 D190A probably damaging Het
Gpr108 C T 17: 57,236,712 G455S probably benign Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Gzf1 T C 2: 148,684,611 I334T probably benign Het
Hadh A T 3: 131,245,239 I156K probably benign Het
Htr5a G A 5: 27,850,889 V293M possibly damaging Het
Ice1 C T 13: 70,602,427 V47M possibly damaging Het
Ifnl3 G T 7: 28,522,929 A32S possibly damaging Het
Itsn2 T A 12: 4,666,176 Y978* probably null Het
Kif1a G T 1: 93,054,329 T792N probably damaging Het
Lgals9 T C 11: 78,973,170 N50D probably benign Het
Lrp2 A G 2: 69,467,090 Y3176H probably damaging Het
Lvrn A T 18: 46,905,307 N976I probably benign Het
Magea10 A T X: 72,382,773 I205K probably benign Het
Myo1c A T 11: 75,670,579 M820L probably damaging Het
Neb A T 2: 52,212,970 C4222* probably null Het
Nkain2 T A 10: 32,890,285 probably benign Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Olfr981 A G 9: 40,022,689 I99V probably benign Het
Parp4 C T 14: 56,613,724 T728M probably damaging Het
Pnmal1 T A 7: 16,961,039 V273D probably benign Het
Ppp1r9b A G 11: 94,996,620 E486G probably damaging Het
Pth2 C A 7: 45,181,722 R98S possibly damaging Het
Rif1 T A 2: 52,081,298 F263I probably damaging Het
Rnf213 A T 11: 119,436,022 I1613F probably damaging Het
Rsbn1l G A 5: 20,902,370 H549Y probably damaging Het
Rtl1 C A 12: 109,593,887 W506L probably damaging Het
Slc4a4 C T 5: 89,028,347 P59L probably damaging Het
Smarcad1 A G 6: 65,073,216 E273G probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ufsp1 T C 5: 137,294,904 probably null Het
Uox A C 3: 146,610,399 K30Q possibly damaging Het
Ush1c A G 7: 46,221,433 S327P probably damaging Het
Wwc1 A T 11: 35,876,547 L419Q probably damaging Het
Xrn1 C T 9: 96,045,563 Q1463* probably null Het
Yeats2 G A 16: 20,186,391 A393T probably benign Het
Zfp101 C T 17: 33,381,517 A422T possibly damaging Het
Other mutations in Ttf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Ttf1 APN 2 29073883 splice site probably benign
IGL00916:Ttf1 APN 2 29070042 missense probably benign 0.05
IGL02148:Ttf1 APN 2 29079426 missense probably benign 0.17
IGL02631:Ttf1 APN 2 29069900 missense probably damaging 0.98
IGL02658:Ttf1 APN 2 29074011 missense probably damaging 1.00
IGL03057:Ttf1 APN 2 29071345 missense probably damaging 0.98
R0026:Ttf1 UTSW 2 29071349 missense possibly damaging 0.95
R0047:Ttf1 UTSW 2 29084655 missense probably damaging 1.00
R0047:Ttf1 UTSW 2 29084655 missense probably damaging 1.00
R0427:Ttf1 UTSW 2 29065042 missense probably benign 0.00
R0466:Ttf1 UTSW 2 29065407 missense possibly damaging 0.79
R0834:Ttf1 UTSW 2 29073950 nonsense probably null
R1548:Ttf1 UTSW 2 29065138 missense probably damaging 0.96
R1672:Ttf1 UTSW 2 29067152 missense probably damaging 0.98
R1696:Ttf1 UTSW 2 29070002 missense probably damaging 1.00
R1819:Ttf1 UTSW 2 29074784 missense possibly damaging 0.60
R2126:Ttf1 UTSW 2 29071345 missense probably damaging 0.98
R2426:Ttf1 UTSW 2 29067185 missense probably damaging 0.98
R2967:Ttf1 UTSW 2 29065383 missense possibly damaging 0.56
R3499:Ttf1 UTSW 2 29065487 missense possibly damaging 0.92
R3963:Ttf1 UTSW 2 29064804 missense possibly damaging 0.68
R4342:Ttf1 UTSW 2 29065476 missense probably benign 0.01
R4627:Ttf1 UTSW 2 29065160 missense possibly damaging 0.72
R4676:Ttf1 UTSW 2 29074594 missense probably damaging 0.96
R4907:Ttf1 UTSW 2 29064656 missense possibly damaging 0.72
R4909:Ttf1 UTSW 2 29064656 missense possibly damaging 0.72
R4926:Ttf1 UTSW 2 29064656 missense possibly damaging 0.72
R4927:Ttf1 UTSW 2 29064656 missense possibly damaging 0.72
R5746:Ttf1 UTSW 2 29065742 missense probably damaging 0.96
R5948:Ttf1 UTSW 2 29073920 missense possibly damaging 0.50
R6911:Ttf1 UTSW 2 29064851 missense probably benign 0.41
X0066:Ttf1 UTSW 2 29074775 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGTTTGGAGAGTGAGCAGCC -3'
(R):5'- CCATGTTCCTGTGGCTTAGCAG -3'

Sequencing Primer
(F):5'- AGAGTGAGCAGCCTCCAGTG -3'
(R):5'- CTAGAAGTCTCTAGCAGGT -3'
Posted On2014-08-25