Incidental Mutation 'R2000:Hadh'
ID225825
Institutional Source Beutler Lab
Gene Symbol Hadh
Ensembl Gene ENSMUSG00000027984
Gene Namehydroxyacyl-Coenzyme A dehydrogenase
SynonymsHadhsc, Schad
MMRRC Submission 040010-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R2000 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location131233419-131272101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131245239 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 156 (I156K)
Ref Sequence ENSEMBL: ENSMUSP00000029610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029610]
Predicted Effect probably benign
Transcript: ENSMUST00000029610
AA Change: I156K

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029610
Gene: ENSMUSG00000027984
AA Change: I156K

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 4 87 1.2e-7 PFAM
Pfam:3HCDH_N 29 214 1.4e-66 PFAM
Pfam:3HCDH 216 313 7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152427
Meta Mutation Damage Score 0.9246 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the 3-hydroxyacyl-CoA dehydrogenase gene family. The encoded protein functions in the mitochondrial matrix to catalyze the oxidation of straight-chain 3-hydroxyacyl-CoAs as part of the beta-oxidation pathway. Its enzymatic activity is highest with medium-chain-length fatty acids. Mutations in this gene cause one form of familial hyperinsulinemic hypoglycemia. The human genome contains a related pseudogene of this gene on chromosome 15. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased susceptibility to diet-induced obesity associated with impaired fatty acid oxidation, impaired fat tolerance, decreased ketone bodies, and increased glucose-stimulated insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf2 T C 2: 73,863,240 probably null Het
Atrn T C 2: 130,935,588 Y186H probably damaging Het
Birc6 T C 17: 74,604,619 V1528A possibly damaging Het
Brpf3 A C 17: 28,821,557 E984A probably benign Het
Btnl9 T C 11: 49,169,121 N600S probably benign Het
C330027C09Rik A T 16: 49,014,969 Q699L probably damaging Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Casp8ap2 T A 4: 32,634,874 L136H probably damaging Het
Cd46 A G 1: 195,077,704 I280T probably benign Het
Crebbp A T 16: 4,084,252 H2374Q probably damaging Het
Dock3 A G 9: 106,992,961 probably benign Het
Dph7 T A 2: 24,971,641 D355E probably benign Het
Dync1li1 C A 9: 114,713,563 F264L probably benign Het
Fer1l6 G A 15: 58,602,311 probably benign Het
Flt3 T C 5: 147,341,238 D842G probably damaging Het
Fosl1 A G 19: 5,450,355 probably benign Het
Gabrr2 T A 4: 33,084,400 I162N probably damaging Het
Gata6 T C 18: 11,054,113 F14S probably benign Het
Gm10767 A T 13: 66,908,150 N69I possibly damaging Het
Gm15446 T C 5: 109,942,811 S310P possibly damaging Het
Gm4759 G A 7: 106,423,231 S188L probably benign Het
Gmppa A C 1: 75,441,528 D190A probably damaging Het
Gpr108 C T 17: 57,236,712 G455S probably benign Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Gzf1 T C 2: 148,684,611 I334T probably benign Het
Htr5a G A 5: 27,850,889 V293M possibly damaging Het
Ice1 C T 13: 70,602,427 V47M possibly damaging Het
Ifnl3 G T 7: 28,522,929 A32S possibly damaging Het
Itsn2 T A 12: 4,666,176 Y978* probably null Het
Kif1a G T 1: 93,054,329 T792N probably damaging Het
Lgals9 T C 11: 78,973,170 N50D probably benign Het
Lrp2 A G 2: 69,467,090 Y3176H probably damaging Het
Lvrn A T 18: 46,905,307 N976I probably benign Het
Magea10 A T X: 72,382,773 I205K probably benign Het
Myo1c A T 11: 75,670,579 M820L probably damaging Het
Neb A T 2: 52,212,970 C4222* probably null Het
Nkain2 T A 10: 32,890,285 probably benign Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Olfr981 A G 9: 40,022,689 I99V probably benign Het
Parp4 C T 14: 56,613,724 T728M probably damaging Het
Pnmal1 T A 7: 16,961,039 V273D probably benign Het
Ppp1r9b A G 11: 94,996,620 E486G probably damaging Het
Pth2 C A 7: 45,181,722 R98S possibly damaging Het
Rif1 T A 2: 52,081,298 F263I probably damaging Het
Rnf213 A T 11: 119,436,022 I1613F probably damaging Het
Rsbn1l G A 5: 20,902,370 H549Y probably damaging Het
Rtl1 C A 12: 109,593,887 W506L probably damaging Het
Slc4a4 C T 5: 89,028,347 P59L probably damaging Het
Smarcad1 A G 6: 65,073,216 E273G probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Ttf1 T A 2: 29,065,185 L187Q possibly damaging Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ufsp1 T C 5: 137,294,904 probably null Het
Uox A C 3: 146,610,399 K30Q possibly damaging Het
Ush1c A G 7: 46,221,433 S327P probably damaging Het
Wwc1 A T 11: 35,876,547 L419Q probably damaging Het
Xrn1 C T 9: 96,045,563 Q1463* probably null Het
Yeats2 G A 16: 20,186,391 A393T probably benign Het
Zfp101 C T 17: 33,381,517 A422T possibly damaging Het
Other mutations in Hadh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Hadh APN 3 131249816 missense probably benign
IGL01062:Hadh APN 3 131240991 missense probably damaging 1.00
IGL01106:Hadh APN 3 131240970 missense possibly damaging 0.89
IGL02629:Hadh APN 3 131235635 missense probably damaging 1.00
IGL02717:Hadh APN 3 131249910 missense probably benign
IGL03180:Hadh APN 3 131271884 missense probably benign 0.08
IGL03240:Hadh APN 3 131248543 missense probably benign
R0081:Hadh UTSW 3 131235636 missense probably damaging 1.00
R1687:Hadh UTSW 3 131245249 missense probably benign 0.00
R4989:Hadh UTSW 3 131235548 nonsense probably null
R6851:Hadh UTSW 3 131271971 missense possibly damaging 0.91
R8787:Hadh UTSW 3 131234176 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATAAGAGCTGCCCTTTCTTCC -3'
(R):5'- GTTGCTGCACCTTCTGACTG -3'

Sequencing Primer
(F):5'- CTCTCCTGAAGAGGACAATTGTGAC -3'
(R):5'- TGACTTCCTCAGCGGGACATG -3'
Posted On2014-08-25