Mutagenetix > Incidental Mutation

Incidental Mutation 'R2000:Uox'

225826

Institutional Source

Beutler Lab

Gene Symbol

Uox

Ensembl Gene

ENSMUSG00000028186

Gene Name

urate oxidase

Synonyms

MMRRC Submission

040010-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.597) question?

Stock #

R2000 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

146570426-146632305 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 146610399 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamine at position 30 (K30Q)

Ref Sequence

ENSEMBL: ENSMUSP00000143418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029837] [ENSMUST00000121133] [ENSMUST00000147409] [ENSMUST00000199489] [ENSMUST00000200633]

AlphaFold

P25688

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029837
AA Change: K54Q

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000029837
Gene: ENSMUSG00000028186
AA Change: K54Q

Domain	Start	End	E-Value	Type
Pfam:Uricase	19	144	8.7e-25	PFAM
Pfam:Uricase	153	292	5.6e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000121133

SMART Domains

Protein: ENSMUSP00000113649
Gene: ENSMUSG00000028186

Domain	Start	End	E-Value	Type
Pfam:Uricase	2	72	1.2e-19	PFAM
Pfam:Uricase	79	181	8.5e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138921

Predicted Effect

possibly damaging
Transcript: ENSMUST00000147409
AA Change: K30Q

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000143299
Gene: ENSMUSG00000028186
AA Change: K30Q

Domain	Start	End	E-Value	Type
Pfam:Uricase	1	73	1.1e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197320

Predicted Effect

possibly damaging
Transcript: ENSMUST00000199489
AA Change: K30Q

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000143418
Gene: ENSMUSG00000028186
AA Change: K30Q

Domain	Start	End	E-Value	Type
Pfam:Uricase	1	121	8.3e-35	PFAM
Pfam:Uricase	128	228	1.8e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000200633

SMART Domains

Protein: ENSMUSP00000142872
Gene: ENSMUSG00000028185

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:DNase_II	26	353	4.5e-117	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

98% (62/63)

MGI Phenotype

PHENOTYPE: Homozygous null mutants exhibit marked hyperuricemia and urate nephropathy. Most mutants die prior to four weeks of age. Homozygotes for a large paracentric inversion disrupting this same gene exhibit a similar phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atf2	T	C	2: 73,863,240		probably null	Het
Atrn	T	C	2: 130,935,588	Y186H	probably damaging	Het
Birc6	T	C	17: 74,604,619	V1528A	possibly damaging	Het
Brpf3	A	C	17: 28,821,557	E984A	probably benign	Het
Btnl9	T	C	11: 49,169,121	N600S	probably benign	Het
C330027C09Rik	A	T	16: 49,014,969	Q699L	probably damaging	Het
Camk1d	A	T	2: 5,362,025	Y126*	probably null	Het
Casp8ap2	T	A	4: 32,634,874	L136H	probably damaging	Het
Cd46	A	G	1: 195,077,704	I280T	probably benign	Het
Crebbp	A	T	16: 4,084,252	H2374Q	probably damaging	Het
Dock3	A	G	9: 106,992,961		probably benign	Het
Dph7	T	A	2: 24,971,641	D355E	probably benign	Het
Dync1li1	C	A	9: 114,713,563	F264L	probably benign	Het
Fer1l6	G	A	15: 58,602,311		probably benign	Het
Flt3	T	C	5: 147,341,238	D842G	probably damaging	Het
Fosl1	A	G	19: 5,450,355		probably benign	Het
Gabrr2	T	A	4: 33,084,400	I162N	probably damaging	Het
Gata6	T	C	18: 11,054,113	F14S	probably benign	Het
Gm10767	A	T	13: 66,908,150	N69I	possibly damaging	Het
Gm15446	T	C	5: 109,942,811	S310P	possibly damaging	Het
Gm4759	G	A	7: 106,423,231	S188L	probably benign	Het
Gmppa	A	C	1: 75,441,528	D190A	probably damaging	Het
Gpr108	C	T	17: 57,236,712	G455S	probably benign	Het
Gstm1	A	G	3: 108,014,811	F170S	probably damaging	Het
Gzf1	T	C	2: 148,684,611	I334T	probably benign	Het
Hadh	A	T	3: 131,245,239	I156K	probably benign	Het
Htr5a	G	A	5: 27,850,889	V293M	possibly damaging	Het
Ice1	C	T	13: 70,602,427	V47M	possibly damaging	Het
Ifnl3	G	T	7: 28,522,929	A32S	possibly damaging	Het
Itsn2	T	A	12: 4,666,176	Y978*	probably null	Het
Kif1a	G	T	1: 93,054,329	T792N	probably damaging	Het
Lgals9	T	C	11: 78,973,170	N50D	probably benign	Het
Lrp2	A	G	2: 69,467,090	Y3176H	probably damaging	Het
Lvrn	A	T	18: 46,905,307	N976I	probably benign	Het
Magea10	A	T	X: 72,382,773	I205K	probably benign	Het
Myo1c	A	T	11: 75,670,579	M820L	probably damaging	Het
Neb	A	T	2: 52,212,970	C4222*	probably null	Het
Nkain2	T	A	10: 32,890,285		probably benign	Het
Olfr1155	G	A	2: 87,943,146	L161F	probably benign	Het
Olfr401	A	G	11: 74,121,580	Y97C	probably benign	Het
Olfr981	A	G	9: 40,022,689	I99V	probably benign	Het
Parp4	C	T	14: 56,613,724	T728M	probably damaging	Het
Pnmal1	T	A	7: 16,961,039	V273D	probably benign	Het
Ppp1r9b	A	G	11: 94,996,620	E486G	probably damaging	Het
Pth2	C	A	7: 45,181,722	R98S	possibly damaging	Het
Rif1	T	A	2: 52,081,298	F263I	probably damaging	Het
Rnf213	A	T	11: 119,436,022	I1613F	probably damaging	Het
Rsbn1l	G	A	5: 20,902,370	H549Y	probably damaging	Het
Rtl1	C	A	12: 109,593,887	W506L	probably damaging	Het
Slc4a4	C	T	5: 89,028,347	P59L	probably damaging	Het
Smarcad1	A	G	6: 65,073,216	E273G	probably damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Ttf1	T	A	2: 29,065,185	L187Q	possibly damaging	Het
Ttn	A	T	2: 76,969,703	I387N	probably damaging	Het
Ufsp1	T	C	5: 137,294,904		probably null	Het
Ush1c	A	G	7: 46,221,433	S327P	probably damaging	Het
Wwc1	A	T	11: 35,876,547	L419Q	probably damaging	Het
Xrn1	C	T	9: 96,045,563	Q1463*	probably null	Het
Yeats2	G	A	16: 20,186,391	A393T	probably benign	Het
Zfp101	C	T	17: 33,381,517	A422T	possibly damaging	Het

Other mutations in Uox

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Uox	APN	3	146627810	missense	probably benign	0.00
IGL00902:Uox	APN	3	146610406	missense	possibly damaging	0.95
IGL02409:Uox	APN	3	146624626	missense	probably benign	0.06
IGL02827:Uox	APN	3	146597196	intron	probably benign
IGL02979:Uox	APN	3	146610491	splice site	probably null
IGL03375:Uox	APN	3	146625835	missense	probably damaging	1.00
kamloops	UTSW	3	146624577	nonsense	probably null
vancouver	UTSW	3	146612292	missense	probably damaging	1.00
R1350:Uox	UTSW	3	146624575	missense	probably damaging	1.00
R1634:Uox	UTSW	3	146612383	nonsense	probably null
R1900:Uox	UTSW	3	146610379	missense	probably damaging	1.00
R2119:Uox	UTSW	3	146612542	missense	probably benign	0.01
R5329:Uox	UTSW	3	146624545	missense	probably damaging	1.00
R5606:Uox	UTSW	3	146610302	nonsense	probably null
R6281:Uox	UTSW	3	146624577	nonsense	probably null
R6327:Uox	UTSW	3	146624577	nonsense	probably null
R6337:Uox	UTSW	3	146624577	nonsense	probably null
R6364:Uox	UTSW	3	146624577	nonsense	probably null
R6365:Uox	UTSW	3	146624577	nonsense	probably null
R6369:Uox	UTSW	3	146624577	nonsense	probably null
R6483:Uox	UTSW	3	146624577	nonsense	probably null
R6492:Uox	UTSW	3	146624577	nonsense	probably null
R6494:Uox	UTSW	3	146624577	nonsense	probably null
R6556:Uox	UTSW	3	146624648	critical splice donor site	probably null
R6803:Uox	UTSW	3	146612509	missense	possibly damaging	0.91
R7809:Uox	UTSW	3	146627858	nonsense	probably null
R7868:Uox	UTSW	3	146610274	missense	probably benign	0.01
R8131:Uox	UTSW	3	146625834	missense	probably damaging	1.00
R8931:Uox	UTSW	3	146612292	missense	probably damaging	1.00
R9088:Uox	UTSW	3	146624614	missense	probably damaging	1.00
R9566:Uox	UTSW	3	146624553	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- CTGGCATGCTTAACTTCACC -3'
(R):5'- CGGAGCAAGCTTTTCTGTAAG -3'

Sequencing Primer
(F):5'- GGCATGCTTAACTTCACCTAGCC -3'
(R):5'- GAAAAGTTTAAAAACGGCATACATGC -3'

Posted On

2014-08-25