Incidental Mutation 'R2000:Casp8ap2'
ID225827
Institutional Source Beutler Lab
Gene Symbol Casp8ap2
Ensembl Gene ENSMUSG00000028282
Gene Namecaspase 8 associated protein 2
SynonymsFLASH, D4Ertd659e
MMRRC Submission 040010-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2000 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location32615451-32653265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32634874 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 136 (L136H)
Ref Sequence ENSEMBL: ENSMUSP00000136016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]
Predicted Effect probably damaging
Transcript: ENSMUST00000029950
AA Change: L136H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: L136H

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000108178
AA Change: L136H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282
AA Change: L136H

DomainStartEndE-ValueType
PDB:2LR8|A 126 190 4e-26 PDB
Blast:SANT 139 183 4e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127619
Predicted Effect probably damaging
Transcript: ENSMUST00000178925
AA Change: L136H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: L136H

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Meta Mutation Damage Score 0.0792 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf2 T C 2: 73,863,240 probably null Het
Atrn T C 2: 130,935,588 Y186H probably damaging Het
Birc6 T C 17: 74,604,619 V1528A possibly damaging Het
Brpf3 A C 17: 28,821,557 E984A probably benign Het
Btnl9 T C 11: 49,169,121 N600S probably benign Het
C330027C09Rik A T 16: 49,014,969 Q699L probably damaging Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Cd46 A G 1: 195,077,704 I280T probably benign Het
Crebbp A T 16: 4,084,252 H2374Q probably damaging Het
Dock3 A G 9: 106,992,961 probably benign Het
Dph7 T A 2: 24,971,641 D355E probably benign Het
Dync1li1 C A 9: 114,713,563 F264L probably benign Het
Fer1l6 G A 15: 58,602,311 probably benign Het
Flt3 T C 5: 147,341,238 D842G probably damaging Het
Fosl1 A G 19: 5,450,355 probably benign Het
Gabrr2 T A 4: 33,084,400 I162N probably damaging Het
Gata6 T C 18: 11,054,113 F14S probably benign Het
Gm10767 A T 13: 66,908,150 N69I possibly damaging Het
Gm15446 T C 5: 109,942,811 S310P possibly damaging Het
Gm4759 G A 7: 106,423,231 S188L probably benign Het
Gmppa A C 1: 75,441,528 D190A probably damaging Het
Gpr108 C T 17: 57,236,712 G455S probably benign Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Gzf1 T C 2: 148,684,611 I334T probably benign Het
Hadh A T 3: 131,245,239 I156K probably benign Het
Htr5a G A 5: 27,850,889 V293M possibly damaging Het
Ice1 C T 13: 70,602,427 V47M possibly damaging Het
Ifnl3 G T 7: 28,522,929 A32S possibly damaging Het
Itsn2 T A 12: 4,666,176 Y978* probably null Het
Kif1a G T 1: 93,054,329 T792N probably damaging Het
Lgals9 T C 11: 78,973,170 N50D probably benign Het
Lrp2 A G 2: 69,467,090 Y3176H probably damaging Het
Lvrn A T 18: 46,905,307 N976I probably benign Het
Magea10 A T X: 72,382,773 I205K probably benign Het
Myo1c A T 11: 75,670,579 M820L probably damaging Het
Neb A T 2: 52,212,970 C4222* probably null Het
Nkain2 T A 10: 32,890,285 probably benign Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Olfr981 A G 9: 40,022,689 I99V probably benign Het
Parp4 C T 14: 56,613,724 T728M probably damaging Het
Pnmal1 T A 7: 16,961,039 V273D probably benign Het
Ppp1r9b A G 11: 94,996,620 E486G probably damaging Het
Pth2 C A 7: 45,181,722 R98S possibly damaging Het
Rif1 T A 2: 52,081,298 F263I probably damaging Het
Rnf213 A T 11: 119,436,022 I1613F probably damaging Het
Rsbn1l G A 5: 20,902,370 H549Y probably damaging Het
Rtl1 C A 12: 109,593,887 W506L probably damaging Het
Slc4a4 C T 5: 89,028,347 P59L probably damaging Het
Smarcad1 A G 6: 65,073,216 E273G probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Ttf1 T A 2: 29,065,185 L187Q possibly damaging Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ufsp1 T C 5: 137,294,904 probably null Het
Uox A C 3: 146,610,399 K30Q possibly damaging Het
Ush1c A G 7: 46,221,433 S327P probably damaging Het
Wwc1 A T 11: 35,876,547 L419Q probably damaging Het
Xrn1 C T 9: 96,045,563 Q1463* probably null Het
Yeats2 G A 16: 20,186,391 A393T probably benign Het
Zfp101 C T 17: 33,381,517 A422T possibly damaging Het
Other mutations in Casp8ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00686:Casp8ap2 APN 4 32641433 missense probably damaging 1.00
IGL00714:Casp8ap2 APN 4 32649192 missense probably damaging 1.00
IGL00754:Casp8ap2 APN 4 32641036 missense probably benign 0.00
IGL00954:Casp8ap2 APN 4 32645403 missense probably damaging 1.00
IGL00970:Casp8ap2 APN 4 32646182 missense probably benign
IGL01534:Casp8ap2 APN 4 32648134 splice site probably benign
IGL01596:Casp8ap2 APN 4 32646365 missense probably damaging 1.00
IGL01686:Casp8ap2 APN 4 32641294 missense possibly damaging 0.94
IGL02002:Casp8ap2 APN 4 32639391 missense probably damaging 1.00
IGL02273:Casp8ap2 APN 4 32643974 missense probably damaging 1.00
IGL02510:Casp8ap2 APN 4 32639704 missense probably benign 0.05
IGL02600:Casp8ap2 APN 4 32630246 missense probably null 1.00
IGL02929:Casp8ap2 APN 4 32624105 utr 5 prime probably benign
F5770:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
IGL02988:Casp8ap2 UTSW 4 32644590 missense probably benign 0.14
R0023:Casp8ap2 UTSW 4 32640185 missense probably damaging 0.99
R0027:Casp8ap2 UTSW 4 32643810 missense probably benign 0.01
R0090:Casp8ap2 UTSW 4 32640327 missense probably damaging 1.00
R0117:Casp8ap2 UTSW 4 32640817 missense probably benign 0.00
R0144:Casp8ap2 UTSW 4 32643797 missense possibly damaging 0.50
R0268:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0344:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0555:Casp8ap2 UTSW 4 32640381 missense probably damaging 1.00
R1051:Casp8ap2 UTSW 4 32640790 missense probably benign 0.28
R1165:Casp8ap2 UTSW 4 32640563 missense probably benign 0.01
R1243:Casp8ap2 UTSW 4 32645687 missense probably benign 0.03
R1311:Casp8ap2 UTSW 4 32648111 missense probably damaging 0.98
R1337:Casp8ap2 UTSW 4 32645721 missense possibly damaging 0.64
R1471:Casp8ap2 UTSW 4 32639386 nonsense probably null
R1497:Casp8ap2 UTSW 4 32639938 missense probably benign 0.00
R1521:Casp8ap2 UTSW 4 32631867 missense probably damaging 1.00
R1588:Casp8ap2 UTSW 4 32640541 missense probably benign 0.00
R1625:Casp8ap2 UTSW 4 32648068 missense probably benign 0.04
R1731:Casp8ap2 UTSW 4 32641442 missense possibly damaging 0.94
R1899:Casp8ap2 UTSW 4 32643647 missense probably damaging 0.98
R2021:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2022:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2023:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2088:Casp8ap2 UTSW 4 32631126 missense probably damaging 1.00
R2104:Casp8ap2 UTSW 4 32644727 missense probably benign 0.00
R2128:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2129:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2305:Casp8ap2 UTSW 4 32646411 missense probably damaging 1.00
R2316:Casp8ap2 UTSW 4 32643781 missense probably benign 0.31
R2919:Casp8ap2 UTSW 4 32645343 missense probably damaging 1.00
R4091:Casp8ap2 UTSW 4 32643611 missense probably damaging 1.00
R4357:Casp8ap2 UTSW 4 32646150 missense probably benign 0.00
R4807:Casp8ap2 UTSW 4 32644505 missense possibly damaging 0.89
R4828:Casp8ap2 UTSW 4 32639807 missense probably benign
R4908:Casp8ap2 UTSW 4 32639905 missense possibly damaging 0.90
R4945:Casp8ap2 UTSW 4 32631163 missense possibly damaging 0.57
R4962:Casp8ap2 UTSW 4 32640554 missense probably damaging 0.99
R6014:Casp8ap2 UTSW 4 32641400 missense probably damaging 0.97
R6092:Casp8ap2 UTSW 4 32639380 missense probably damaging 1.00
R6257:Casp8ap2 UTSW 4 32641364 missense possibly damaging 0.94
R6289:Casp8ap2 UTSW 4 32639590 missense probably damaging 1.00
R6482:Casp8ap2 UTSW 4 32634813 missense probably damaging 1.00
R6496:Casp8ap2 UTSW 4 32641553 missense probably benign 0.05
R6515:Casp8ap2 UTSW 4 32646423 missense possibly damaging 0.64
R7015:Casp8ap2 UTSW 4 32644278 missense probably damaging 1.00
R7033:Casp8ap2 UTSW 4 32639392 missense probably damaging 1.00
R7072:Casp8ap2 UTSW 4 32644766 missense probably damaging 1.00
R7448:Casp8ap2 UTSW 4 32643974 missense possibly damaging 0.84
V7580:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
X0018:Casp8ap2 UTSW 4 32643738 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGGGAGCCACATCTTAGAATTAC -3'
(R):5'- GTGGCAATGTTCCATCAGTAAC -3'

Sequencing Primer
(F):5'- AATCCCCATATTGGAGGCTG -3'
(R):5'- GTTCCATCAGTAACCATAGGTGTCAC -3'
Posted On2014-08-25