Incidental Mutation 'R2000:Itsn2'
ID225855
Institutional Source Beutler Lab
Gene Symbol Itsn2
Ensembl Gene ENSMUSG00000020640
Gene Nameintersectin 2
SynonymsSh3d1B, Eh domain, SH3 domain regulator of endocytosis 2, Ese2, Sh3p18
MMRRC Submission 040010-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2000 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location4592638-4713962 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 4666176 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 978 (Y978*)
Ref Sequence ENSEMBL: ENSMUSP00000151896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062580] [ENSMUST00000219007] [ENSMUST00000220311]
Predicted Effect probably null
Transcript: ENSMUST00000062580
AA Change: Y951*
SMART Domains Protein: ENSMUSP00000052758
Gene: ENSMUSG00000020640
AA Change: Y951*

DomainStartEndE-ValueType
EH 15 109 8.44e-41 SMART
EFh 58 86 7.18e-3 SMART
low complexity region 156 169 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
EH 238 333 4.06e-43 SMART
EFh 282 310 6.16e-2 SMART
coiled coil region 366 462 N/A INTRINSIC
coiled coil region 516 556 N/A INTRINSIC
coiled coil region 580 715 N/A INTRINSIC
SH3 721 778 2.65e-21 SMART
low complexity region 791 811 N/A INTRINSIC
SH3 855 909 8.83e-18 SMART
SH3 945 999 9.1e-20 SMART
SH3 1017 1077 1.55e-13 SMART
SH3 1091 1146 7.22e-23 SMART
RhoGEF 1174 1355 1.93e-56 SMART
PH 1396 1507 1.16e-9 SMART
C2 1531 1628 3.96e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000217672
AA Change: Y509*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218985
Predicted Effect probably null
Transcript: ENSMUST00000219007
AA Change: Y951*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219832
Predicted Effect probably null
Transcript: ENSMUST00000220311
AA Change: Y978*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains SH3 domains. This protein is a member of a family of proteins involved in clathrin-mediated endocytosis. Intersectin 2 is thought to regulate the formation of clathrin-coated vesicles and also may function in the induction of T cell antigen receptor (TCR) endocytosis. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal brain morphology and function and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf2 T C 2: 73,863,240 probably null Het
Atrn T C 2: 130,935,588 Y186H probably damaging Het
Birc6 T C 17: 74,604,619 V1528A possibly damaging Het
Brpf3 A C 17: 28,821,557 E984A probably benign Het
Btnl9 T C 11: 49,169,121 N600S probably benign Het
C330027C09Rik A T 16: 49,014,969 Q699L probably damaging Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Casp8ap2 T A 4: 32,634,874 L136H probably damaging Het
Cd46 A G 1: 195,077,704 I280T probably benign Het
Crebbp A T 16: 4,084,252 H2374Q probably damaging Het
Dock3 A G 9: 106,992,961 probably benign Het
Dph7 T A 2: 24,971,641 D355E probably benign Het
Dync1li1 C A 9: 114,713,563 F264L probably benign Het
Fer1l6 G A 15: 58,602,311 probably benign Het
Flt3 T C 5: 147,341,238 D842G probably damaging Het
Fosl1 A G 19: 5,450,355 probably benign Het
Gabrr2 T A 4: 33,084,400 I162N probably damaging Het
Gata6 T C 18: 11,054,113 F14S probably benign Het
Gm10767 A T 13: 66,908,150 N69I possibly damaging Het
Gm15446 T C 5: 109,942,811 S310P possibly damaging Het
Gm4759 G A 7: 106,423,231 S188L probably benign Het
Gmppa A C 1: 75,441,528 D190A probably damaging Het
Gpr108 C T 17: 57,236,712 G455S probably benign Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Gzf1 T C 2: 148,684,611 I334T probably benign Het
Hadh A T 3: 131,245,239 I156K probably benign Het
Htr5a G A 5: 27,850,889 V293M possibly damaging Het
Ice1 C T 13: 70,602,427 V47M possibly damaging Het
Ifnl3 G T 7: 28,522,929 A32S possibly damaging Het
Kif1a G T 1: 93,054,329 T792N probably damaging Het
Lgals9 T C 11: 78,973,170 N50D probably benign Het
Lrp2 A G 2: 69,467,090 Y3176H probably damaging Het
Lvrn A T 18: 46,905,307 N976I probably benign Het
Magea10 A T X: 72,382,773 I205K probably benign Het
Myo1c A T 11: 75,670,579 M820L probably damaging Het
Neb A T 2: 52,212,970 C4222* probably null Het
Nkain2 T A 10: 32,890,285 probably benign Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Olfr981 A G 9: 40,022,689 I99V probably benign Het
Parp4 C T 14: 56,613,724 T728M probably damaging Het
Pnmal1 T A 7: 16,961,039 V273D probably benign Het
Ppp1r9b A G 11: 94,996,620 E486G probably damaging Het
Pth2 C A 7: 45,181,722 R98S possibly damaging Het
Rif1 T A 2: 52,081,298 F263I probably damaging Het
Rnf213 A T 11: 119,436,022 I1613F probably damaging Het
Rsbn1l G A 5: 20,902,370 H549Y probably damaging Het
Rtl1 C A 12: 109,593,887 W506L probably damaging Het
Slc4a4 C T 5: 89,028,347 P59L probably damaging Het
Smarcad1 A G 6: 65,073,216 E273G probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Ttf1 T A 2: 29,065,185 L187Q possibly damaging Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ufsp1 T C 5: 137,294,904 probably null Het
Uox A C 3: 146,610,399 K30Q possibly damaging Het
Ush1c A G 7: 46,221,433 S327P probably damaging Het
Wwc1 A T 11: 35,876,547 L419Q probably damaging Het
Xrn1 C T 9: 96,045,563 Q1463* probably null Het
Yeats2 G A 16: 20,186,391 A393T probably benign Het
Zfp101 C T 17: 33,381,517 A422T possibly damaging Het
Other mutations in Itsn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Itsn2 APN 12 4658027 missense possibly damaging 0.95
IGL00647:Itsn2 APN 12 4613311 splice site probably benign
IGL00933:Itsn2 APN 12 4707540 missense probably damaging 1.00
IGL01686:Itsn2 APN 12 4636693 splice site probably benign
IGL01873:Itsn2 APN 12 4632366 splice site probably benign
IGL02200:Itsn2 APN 12 4636632 missense probably damaging 0.98
IGL02280:Itsn2 APN 12 4708961 missense possibly damaging 0.89
IGL02388:Itsn2 APN 12 4629557 missense possibly damaging 0.91
IGL02938:Itsn2 APN 12 4697216 missense probably damaging 0.98
inversus UTSW 12 4639670 nonsense probably null
Liberator UTSW 12 4666176 nonsense probably null
rolled UTSW 12 4634792 nonsense probably null
Stratofortress UTSW 12 4624927 missense probably damaging 1.00
R0101:Itsn2 UTSW 12 4633058 unclassified probably benign
R0268:Itsn2 UTSW 12 4700333 missense probably benign 0.12
R0584:Itsn2 UTSW 12 4697180 missense probably benign
R0604:Itsn2 UTSW 12 4658189 missense probably benign 0.01
R0639:Itsn2 UTSW 12 4712556 missense probably damaging 0.99
R0738:Itsn2 UTSW 12 4635681 missense probably benign 0.17
R1132:Itsn2 UTSW 12 4658464 missense probably damaging 1.00
R1163:Itsn2 UTSW 12 4712009 missense probably benign 0.30
R1169:Itsn2 UTSW 12 4639694 missense probably damaging 1.00
R1258:Itsn2 UTSW 12 4673464 missense probably damaging 1.00
R1297:Itsn2 UTSW 12 4700378 missense probably damaging 1.00
R1423:Itsn2 UTSW 12 4673572 missense probably damaging 0.97
R1572:Itsn2 UTSW 12 4650044 missense probably benign 0.03
R1601:Itsn2 UTSW 12 4658452 missense probably benign 0.01
R1628:Itsn2 UTSW 12 4629652 missense probably benign
R1650:Itsn2 UTSW 12 4637767 missense probably damaging 0.97
R1752:Itsn2 UTSW 12 4711950 splice site probably null
R1758:Itsn2 UTSW 12 4658160 missense possibly damaging 0.83
R1942:Itsn2 UTSW 12 4639670 nonsense probably null
R1976:Itsn2 UTSW 12 4672733 splice site probably benign
R2060:Itsn2 UTSW 12 4627879 missense probably damaging 1.00
R2119:Itsn2 UTSW 12 4707025 missense probably benign 0.32
R2168:Itsn2 UTSW 12 4633044 unclassified probably benign
R2394:Itsn2 UTSW 12 4707005 missense possibly damaging 0.86
R2860:Itsn2 UTSW 12 4700315 splice site probably benign
R2861:Itsn2 UTSW 12 4700315 splice site probably benign
R2900:Itsn2 UTSW 12 4630713 unclassified probably benign
R2991:Itsn2 UTSW 12 4658474 missense probably benign 0.01
R3087:Itsn2 UTSW 12 4666303 missense probably damaging 1.00
R3881:Itsn2 UTSW 12 4634546 unclassified probably benign
R4022:Itsn2 UTSW 12 4624927 missense probably damaging 1.00
R4332:Itsn2 UTSW 12 4712611 missense possibly damaging 0.72
R4657:Itsn2 UTSW 12 4713197 makesense probably null
R4727:Itsn2 UTSW 12 4707660 missense probably damaging 0.99
R4745:Itsn2 UTSW 12 4661944 missense probably damaging 1.00
R4770:Itsn2 UTSW 12 4627892 missense probably damaging 1.00
R4905:Itsn2 UTSW 12 4634583 unclassified probably benign
R5269:Itsn2 UTSW 12 4633553 unclassified probably benign
R5314:Itsn2 UTSW 12 4627960 missense probably benign 0.09
R5345:Itsn2 UTSW 12 4672783 missense probably damaging 1.00
R5399:Itsn2 UTSW 12 4653535 missense probably benign 0.22
R5566:Itsn2 UTSW 12 4626554 missense probably damaging 1.00
R5725:Itsn2 UTSW 12 4630767 unclassified probably benign
R5773:Itsn2 UTSW 12 4707089 missense probably damaging 1.00
R6116:Itsn2 UTSW 12 4629939 unclassified probably benign
R6254:Itsn2 UTSW 12 4624982 splice site probably null
R6325:Itsn2 UTSW 12 4706351 missense probably damaging 1.00
R6361:Itsn2 UTSW 12 4629655 missense probably benign 0.18
R6456:Itsn2 UTSW 12 4629923 unclassified probably benign
R6494:Itsn2 UTSW 12 4634792 nonsense probably null
R6854:Itsn2 UTSW 12 4652382 missense probably benign 0.37
R6941:Itsn2 UTSW 12 4629641 missense probably benign 0.05
R6961:Itsn2 UTSW 12 4673420 nonsense probably null
R7326:Itsn2 UTSW 12 4632985 missense unknown
R7387:Itsn2 UTSW 12 4639781 missense probably damaging 1.00
R7465:Itsn2 UTSW 12 4706983 nonsense probably null
R7471:Itsn2 UTSW 12 4708198 missense probably benign 0.43
Z1088:Itsn2 UTSW 12 4712472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGACAGTTGTTAACCGATGGC -3'
(R):5'- AGCAAGTATCTTGATTGGGAACAAC -3'

Sequencing Primer
(F):5'- AGTTGTTAACCGATGGCTTCTATTC -3'
(R):5'- TGGGAACAACAGAACGCTTTTG -3'
Posted On2014-08-25