Incidental Mutation 'R2000:Tectb'
ID225872
Institutional Source Beutler Lab
Gene Symbol Tectb
Ensembl Gene ENSMUSG00000024979
Gene Nametectorin beta
Synonyms[b]-tectorin, Tctnb
MMRRC Submission 040010-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R2000 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location55180733-55196313 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to G at 55180999 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025936] [ENSMUST00000120936] [ENSMUST00000154886]
Predicted Effect probably benign
Transcript: ENSMUST00000025936
SMART Domains Protein: ENSMUSP00000025936
Gene: ENSMUSG00000024979

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
ZP 31 283 3.47e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120936
SMART Domains Protein: ENSMUSP00000113805
Gene: ENSMUSG00000024979

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
ZP 31 293 1.9e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154886
SMART Domains Protein: ENSMUSP00000121767
Gene: ENSMUSG00000024979

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
ZP 31 196 6.19e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-collagenous glycoprotein component of the tectorial membrane, which covers the auditory hair cells in the cochlea of the inner ear. A similar protein in mouse functions in low-frequency hearing. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null allele show an enlarged tectorial membrane with a disrupted striated-sheet matrix, absence of the marginal band, and low-frequency hearing loss. However, basilar-membrane and neural tuning are both enhanced in high-frequency cochlear regions, with little loss in sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf2 T C 2: 73,863,240 probably null Het
Atrn T C 2: 130,935,588 Y186H probably damaging Het
Birc6 T C 17: 74,604,619 V1528A possibly damaging Het
Brpf3 A C 17: 28,821,557 E984A probably benign Het
Btnl9 T C 11: 49,169,121 N600S probably benign Het
C330027C09Rik A T 16: 49,014,969 Q699L probably damaging Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Casp8ap2 T A 4: 32,634,874 L136H probably damaging Het
Cd46 A G 1: 195,077,704 I280T probably benign Het
Crebbp A T 16: 4,084,252 H2374Q probably damaging Het
Dock3 A G 9: 106,992,961 probably benign Het
Dph7 T A 2: 24,971,641 D355E probably benign Het
Dync1li1 C A 9: 114,713,563 F264L probably benign Het
Fer1l6 G A 15: 58,602,311 probably benign Het
Flt3 T C 5: 147,341,238 D842G probably damaging Het
Fosl1 A G 19: 5,450,355 probably benign Het
Gabrr2 T A 4: 33,084,400 I162N probably damaging Het
Gata6 T C 18: 11,054,113 F14S probably benign Het
Gm10767 A T 13: 66,908,150 N69I possibly damaging Het
Gm15446 T C 5: 109,942,811 S310P possibly damaging Het
Gm4759 G A 7: 106,423,231 S188L probably benign Het
Gmppa A C 1: 75,441,528 D190A probably damaging Het
Gpr108 C T 17: 57,236,712 G455S probably benign Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Gzf1 T C 2: 148,684,611 I334T probably benign Het
Hadh A T 3: 131,245,239 I156K probably benign Het
Htr5a G A 5: 27,850,889 V293M possibly damaging Het
Ice1 C T 13: 70,602,427 V47M possibly damaging Het
Ifnl3 G T 7: 28,522,929 A32S possibly damaging Het
Itsn2 T A 12: 4,666,176 Y978* probably null Het
Kif1a G T 1: 93,054,329 T792N probably damaging Het
Lgals9 T C 11: 78,973,170 N50D probably benign Het
Lrp2 A G 2: 69,467,090 Y3176H probably damaging Het
Lvrn A T 18: 46,905,307 N976I probably benign Het
Magea10 A T X: 72,382,773 I205K probably benign Het
Myo1c A T 11: 75,670,579 M820L probably damaging Het
Neb A T 2: 52,212,970 C4222* probably null Het
Nkain2 T A 10: 32,890,285 probably benign Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Olfr981 A G 9: 40,022,689 I99V probably benign Het
Parp4 C T 14: 56,613,724 T728M probably damaging Het
Pnmal1 T A 7: 16,961,039 V273D probably benign Het
Ppp1r9b A G 11: 94,996,620 E486G probably damaging Het
Pth2 C A 7: 45,181,722 R98S possibly damaging Het
Rif1 T A 2: 52,081,298 F263I probably damaging Het
Rnf213 A T 11: 119,436,022 I1613F probably damaging Het
Rsbn1l G A 5: 20,902,370 H549Y probably damaging Het
Rtl1 C A 12: 109,593,887 W506L probably damaging Het
Slc4a4 C T 5: 89,028,347 P59L probably damaging Het
Smarcad1 A G 6: 65,073,216 E273G probably damaging Het
Ttf1 T A 2: 29,065,185 L187Q possibly damaging Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ufsp1 T C 5: 137,294,904 probably null Het
Uox A C 3: 146,610,399 K30Q possibly damaging Het
Ush1c A G 7: 46,221,433 S327P probably damaging Het
Wwc1 A T 11: 35,876,547 L419Q probably damaging Het
Xrn1 C T 9: 96,045,563 Q1463* probably null Het
Yeats2 G A 16: 20,186,391 A393T probably benign Het
Zfp101 C T 17: 33,381,517 A422T possibly damaging Het
Other mutations in Tectb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01754:Tectb APN 19 55184013 missense probably damaging 1.00
IGL02001:Tectb APN 19 55189595 missense possibly damaging 0.48
IGL02510:Tectb APN 19 55191511 missense probably damaging 1.00
R0028:Tectb UTSW 19 55194677 missense probably benign 0.01
R0130:Tectb UTSW 19 55181961 missense probably damaging 0.99
R0586:Tectb UTSW 19 55181924 missense probably damaging 1.00
R0598:Tectb UTSW 19 55189586 nonsense probably null
R0655:Tectb UTSW 19 55189870 missense possibly damaging 0.78
R0708:Tectb UTSW 19 55191552 missense probably benign 0.37
R1314:Tectb UTSW 19 55183985 missense probably damaging 1.00
R1999:Tectb UTSW 19 55180999 start gained probably benign
R2024:Tectb UTSW 19 55181929 missense probably damaging 1.00
R2148:Tectb UTSW 19 55180999 start gained probably benign
R2159:Tectb UTSW 19 55180999 start gained probably benign
R2160:Tectb UTSW 19 55180999 start gained probably benign
R2161:Tectb UTSW 19 55180999 start gained probably benign
R2162:Tectb UTSW 19 55180999 start gained probably benign
R2355:Tectb UTSW 19 55180999 start gained probably benign
R2358:Tectb UTSW 19 55180999 start gained probably benign
R2495:Tectb UTSW 19 55180999 start gained probably benign
R2497:Tectb UTSW 19 55180999 start gained probably benign
R2511:Tectb UTSW 19 55180999 start gained probably benign
R2568:Tectb UTSW 19 55180999 start gained probably benign
R2570:Tectb UTSW 19 55180999 start gained probably benign
R2848:Tectb UTSW 19 55180999 start gained probably benign
R2897:Tectb UTSW 19 55180999 start gained probably benign
R2898:Tectb UTSW 19 55180999 start gained probably benign
R3712:Tectb UTSW 19 55180999 start gained probably benign
R5671:Tectb UTSW 19 55192627 missense probably benign 0.42
R5875:Tectb UTSW 19 55189626 missense possibly damaging 0.94
R6312:Tectb UTSW 19 55192662 frame shift probably null
R6315:Tectb UTSW 19 55191472 missense possibly damaging 0.73
R6366:Tectb UTSW 19 55181918 missense probably damaging 1.00
R7729:Tectb UTSW 19 55192672 missense
Predicted Primers PCR Primer
(F):5'- AGCATCACCGAGCTCTCTTG -3'
(R):5'- AAGTCTGATTGGCACTGGGG -3'

Sequencing Primer
(F):5'- TCACCGAGCTCTCTTGGAAAC -3'
(R):5'- GCACTGGGGACTTCTGTTCC -3'
Posted On2014-08-25