Incidental Mutation 'R2001:Sphkap'
ID225878
Institutional Source Beutler Lab
Gene Symbol Sphkap
Ensembl Gene ENSMUSG00000026163
Gene NameSPHK1 interactor, AKAP domain containing
Synonyms4930544G21Rik, A930009L15Rik, SKIP
MMRRC Submission 040011-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R2001 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location83254139-83408200 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83276662 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 835 (M835K)
Ref Sequence ENSEMBL: ENSMUSP00000124384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159078] [ENSMUST00000160953]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053075
Predicted Effect probably damaging
Transcript: ENSMUST00000159078
AA Change: M835K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124384
Gene: ENSMUSG00000026163
AA Change: M835K

DomainStartEndE-ValueType
low complexity region 303 314 N/A INTRINSIC
SCOP:d1ash__ 382 462 5e-3 SMART
low complexity region 809 819 N/A INTRINSIC
low complexity region 854 865 N/A INTRINSIC
low complexity region 1202 1221 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
Pfam:AKAP_110 1281 1398 7.5e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160953
AA Change: M1122K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124872
Gene: ENSMUSG00000026163
AA Change: M1122K

DomainStartEndE-ValueType
low complexity region 590 601 N/A INTRINSIC
SCOP:d1ash__ 669 749 6e-3 SMART
low complexity region 1096 1106 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
low complexity region 1489 1508 N/A INTRINSIC
Pfam:AKAP_110 1540 1655 6.4e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,741,456 S559P probably benign Het
A430005L14Rik T A 4: 153,959,857 C42S probably damaging Het
Abca13 A T 11: 9,273,967 T449S probably benign Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Adamts13 C T 2: 26,973,990 P60L probably benign Het
Adamts20 T C 15: 94,347,718 T568A possibly damaging Het
Ago1 T C 4: 126,454,394 I44V probably null Het
Agtpbp1 TGAAGATGCATCTTGAGAAGA TGAAGA 13: 59,475,803 probably null Het
Ankrd28 A T 14: 31,745,336 V39E possibly damaging Het
Apaf1 A G 10: 91,061,814 V269A possibly damaging Het
Asna1 T C 8: 85,025,160 S36G probably damaging Het
Astn1 A G 1: 158,520,521 N506D probably damaging Het
BC051019 G A 7: 109,720,551 Q102* probably null Het
Bpifb5 A G 2: 154,233,279 T376A possibly damaging Het
Ccdc121 G T 1: 181,510,986 Q134K probably benign Het
Ccl20 ATT ATTT 1: 83,117,855 probably null Het
Ccl6 G T 11: 83,589,337 P68T possibly damaging Het
Cd300ld A T 11: 114,987,330 F119I probably benign Het
Cdk2ap2 A G 19: 4,097,903 M57V possibly damaging Het
Chkb C T 15: 89,428,766 G36E probably damaging Het
Col11a1 A G 3: 114,165,293 probably null Het
Ctla2b T C 13: 60,896,067 Y120C probably damaging Het
Ctnnd1 T C 2: 84,620,360 N172S probably benign Het
Cyp2a22 G A 7: 26,934,772 P319L probably damaging Het
Dcaf12 A C 4: 41,302,804 V117G probably damaging Het
Ddx6 A G 9: 44,607,534 T48A probably benign Het
Dgki T C 6: 36,865,801 D923G possibly damaging Het
Dhx37 G T 5: 125,427,464 T345K probably damaging Het
Dhx9 A T 1: 153,456,111 Y1370* probably null Het
Dnah7b T C 1: 46,142,087 S1045P possibly damaging Het
Dnmbp G C 19: 43,850,173 T1071S possibly damaging Het
Dspp T A 5: 104,178,559 S929R unknown Het
Dst A T 1: 34,184,063 E1625D probably damaging Het
Egflam T A 15: 7,242,567 H630L probably benign Het
Elane T C 10: 79,887,759 V186A possibly damaging Het
Fam209 C A 2: 172,472,769 N59K probably benign Het
Gbe1 A G 16: 70,528,926 E617G probably damaging Het
Gfra1 A G 19: 58,300,275 L246P probably damaging Het
Gm14139 T A 2: 150,192,947 M396K probably benign Het
Gria2 T C 3: 80,710,805 T308A probably benign Het
Grip2 A T 6: 91,779,850 V540D probably benign Het
Hhipl1 A T 12: 108,321,859 I575F possibly damaging Het
Hmcn1 T A 1: 150,738,613 E1347D possibly damaging Het
Itga2b C A 11: 102,467,339 A187S probably benign Het
Kalrn C A 16: 34,028,045 R469M probably damaging Het
Kif23 A T 9: 61,927,384 C426* probably null Het
Lck T C 4: 129,548,937 N475S probably benign Het
Leng8 A G 7: 4,145,074 N642S probably damaging Het
Lingo4 T A 3: 94,403,075 I440N probably damaging Het
Lrrc4 A G 6: 28,830,905 F237S probably damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Naip2 A T 13: 100,144,588 I1316N probably damaging Het
Naip6 C T 13: 100,300,729 G429S probably benign Het
Noct C T 3: 51,248,044 R78C probably damaging Het
Npbwr1 A G 1: 5,917,175 V40A possibly damaging Het
Nsd2 A G 5: 33,843,402 N88D probably damaging Het
Olfr1020 T A 2: 85,850,400 V316E probably benign Het
Olfr1066 T C 2: 86,455,473 H266R probably benign Het
Olfr389 T A 11: 73,776,713 I205F probably benign Het
Olfr800 T A 10: 129,660,421 I205N probably benign Het
Pak7 T A 2: 136,116,637 H177L probably benign Het
Pard3 C T 8: 127,064,347 probably null Het
Pde4c A G 8: 70,747,358 probably null Het
Pde6h T A 6: 136,963,205 I63N probably damaging Het
Phldb2 T C 16: 45,774,195 K916E possibly damaging Het
Ppig T C 2: 69,741,644 S236P unknown Het
Ptprd T C 4: 75,954,122 Y1370C probably damaging Het
Pzp T C 6: 128,516,120 T352A probably benign Het
Rab3gap1 A G 1: 127,903,719 Y177C possibly damaging Het
Rasgef1a G A 6: 118,089,196 V457M probably benign Het
Scel A T 14: 103,610,790 T616S possibly damaging Het
Sel1l A T 12: 91,826,550 Y228* probably null Het
Sgms1 A G 19: 32,159,683 V161A possibly damaging Het
Slfnl1 T C 4: 120,533,227 L25P probably benign Het
Smad5 A G 13: 56,737,374 T432A probably damaging Het
Sohlh2 T C 3: 55,192,341 probably null Het
Sqor A C 2: 122,798,098 T174P probably damaging Het
Stkld1 T C 2: 26,952,747 V577A probably damaging Het
Sulf2 T A 2: 166,080,853 E652D probably benign Het
Sycp2 T A 2: 178,378,055 Q556L probably benign Het
Syk A G 13: 52,611,238 T134A probably benign Het
Tas2r122 T A 6: 132,711,622 I103F possibly damaging Het
Tex10 A G 4: 48,451,940 W729R probably damaging Het
Tex261 G T 6: 83,773,731 P95T probably damaging Het
Tm2d2 T C 8: 25,017,507 S47P probably benign Het
Tmem2 A G 19: 21,801,987 D387G probably benign Het
Tmem95 A G 11: 69,876,991 S128P probably damaging Het
Tnxb G A 17: 34,692,579 A1619T possibly damaging Het
Trappc9 A G 15: 73,058,036 I157T probably damaging Het
Unc13c T A 9: 73,483,615 probably null Het
Upb1 A T 10: 75,429,969 Y210F probably damaging Het
Urb1 T C 16: 90,762,344 M1684V probably benign Het
Wnk2 G A 13: 49,078,682 P727S possibly damaging Het
Zfp551 A T 7: 12,416,349 S378T probably damaging Het
Zfp598 T C 17: 24,669,924 V56A possibly damaging Het
Zfp945 C T 17: 22,857,249 probably null Het
Other mutations in Sphkap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Sphkap APN 1 83280516 missense probably damaging 1.00
IGL00337:Sphkap APN 1 83339608 missense probably damaging 1.00
IGL00470:Sphkap APN 1 83277910 missense possibly damaging 0.87
IGL00577:Sphkap APN 1 83278844 missense probably damaging 1.00
IGL00657:Sphkap APN 1 83276375 missense probably damaging 1.00
IGL01868:Sphkap APN 1 83280399 unclassified probably null
IGL02101:Sphkap APN 1 83290987 missense probably damaging 1.00
IGL02471:Sphkap APN 1 83276176 missense probably damaging 1.00
IGL02943:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL02945:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03008:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03031:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03059:Sphkap APN 1 83257242 missense probably damaging 0.97
IGL03085:Sphkap APN 1 83280354 missense possibly damaging 0.92
IGL03355:Sphkap APN 1 83280503 missense probably damaging 1.00
IGL03356:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03368:Sphkap APN 1 83275676 missense probably benign 0.14
R0294:Sphkap UTSW 1 83278245 missense possibly damaging 0.72
R0308:Sphkap UTSW 1 83276969 missense probably damaging 1.00
R0478:Sphkap UTSW 1 83278711 missense probably damaging 1.00
R0606:Sphkap UTSW 1 83280424 missense probably damaging 1.00
R0678:Sphkap UTSW 1 83278628 missense probably benign 0.03
R1216:Sphkap UTSW 1 83290977 missense probably damaging 1.00
R1253:Sphkap UTSW 1 83278898 missense possibly damaging 0.56
R1532:Sphkap UTSW 1 83257203 missense probably damaging 1.00
R1635:Sphkap UTSW 1 83278400 missense probably benign 0.03
R1655:Sphkap UTSW 1 83277515 nonsense probably null
R1657:Sphkap UTSW 1 83277515 nonsense probably null
R1700:Sphkap UTSW 1 83277515 nonsense probably null
R1701:Sphkap UTSW 1 83277515 nonsense probably null
R1734:Sphkap UTSW 1 83277515 nonsense probably null
R1736:Sphkap UTSW 1 83277515 nonsense probably null
R1743:Sphkap UTSW 1 83277515 nonsense probably null
R1744:Sphkap UTSW 1 83277515 nonsense probably null
R1760:Sphkap UTSW 1 83277544 missense probably benign 0.29
R1893:Sphkap UTSW 1 83278966 missense probably benign 0.02
R1937:Sphkap UTSW 1 83267441 nonsense probably null
R1986:Sphkap UTSW 1 83277922 missense probably damaging 1.00
R1993:Sphkap UTSW 1 83277515 nonsense probably null
R1995:Sphkap UTSW 1 83277515 nonsense probably null
R2004:Sphkap UTSW 1 83277911 missense probably benign 0.04
R2111:Sphkap UTSW 1 83275881 missense probably benign 0.00
R2112:Sphkap UTSW 1 83275881 missense probably benign 0.00
R2156:Sphkap UTSW 1 83277989 missense probably benign 0.03
R2182:Sphkap UTSW 1 83276684 missense probably damaging 1.00
R2271:Sphkap UTSW 1 83257221 missense probably damaging 1.00
R3712:Sphkap UTSW 1 83277112 missense probably benign 0.27
R3919:Sphkap UTSW 1 83276458 missense probably damaging 1.00
R3980:Sphkap UTSW 1 83267494 splice site probably null
R4130:Sphkap UTSW 1 83277898 missense probably damaging 0.96
R4539:Sphkap UTSW 1 83277793 missense probably benign 0.00
R4602:Sphkap UTSW 1 83279061 nonsense probably null
R4735:Sphkap UTSW 1 83279117 missense probably benign 0.01
R4793:Sphkap UTSW 1 83278084 missense possibly damaging 0.77
R4849:Sphkap UTSW 1 83277384 missense probably benign 0.03
R4880:Sphkap UTSW 1 83288817 missense probably damaging 1.00
R5213:Sphkap UTSW 1 83280503 missense probably damaging 1.00
R5277:Sphkap UTSW 1 83276164 missense probably benign 0.04
R5331:Sphkap UTSW 1 83276782 missense probably benign 0.08
R5632:Sphkap UTSW 1 83278285 missense probably benign 0.01
R5647:Sphkap UTSW 1 83407999 missense probably damaging 0.98
R5751:Sphkap UTSW 1 83275897 missense probably benign 0.27
R5935:Sphkap UTSW 1 83339599 missense probably damaging 1.00
R5999:Sphkap UTSW 1 83267405 missense probably benign 0.02
R6232:Sphkap UTSW 1 83280479 missense probably damaging 1.00
R6318:Sphkap UTSW 1 83278378 missense probably damaging 1.00
R6474:Sphkap UTSW 1 83278823 missense probably damaging 1.00
R6602:Sphkap UTSW 1 83275758 missense possibly damaging 0.75
R6674:Sphkap UTSW 1 83277834 missense probably benign 0.37
R6716:Sphkap UTSW 1 83362228 critical splice donor site probably null
R6803:Sphkap UTSW 1 83280510 missense probably damaging 1.00
R6880:Sphkap UTSW 1 83257257 missense probably damaging 1.00
R6941:Sphkap UTSW 1 83408090 start gained probably benign
R7170:Sphkap UTSW 1 83265985 missense probably damaging 0.99
R7263:Sphkap UTSW 1 83276678 missense probably damaging 1.00
R7422:Sphkap UTSW 1 83263826 missense probably benign 0.02
R7640:Sphkap UTSW 1 83278928 missense possibly damaging 0.94
R7722:Sphkap UTSW 1 83278921 missense probably benign 0.00
R7810:Sphkap UTSW 1 83276300 missense probably damaging 1.00
Z1088:Sphkap UTSW 1 83276608 missense probably damaging 1.00
Z1088:Sphkap UTSW 1 83278604 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCGATGTCCCTTAACATG -3'
(R):5'- TCACAGAGTTTTCCATGGTGG -3'

Sequencing Primer
(F):5'- CGATGTCCCTTAACATGTACCTATAG -3'
(R):5'- AAGGCCAGAGTTGTTCCCG -3'
Posted On2014-08-25