Mutagenetix > Incidental Mutation

Incidental Mutation 'R2001:Adamts13'

225888

Institutional Source

Beutler Lab

Gene Symbol

Adamts13

Ensembl Gene

ENSMUSG00000014852

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13

Synonyms

vWF-CP mRNA for von Willebrand factor-cleaving, LOC279028

MMRRC Submission

040011-MU

Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R2001 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

26973416-27009628 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 26973990 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 60 (P60L)

Ref Sequence

ENSEMBL: ENSMUSP00000099955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014996] [ENSMUST00000102891]

AlphaFold

Q769J6

Predicted Effect

probably benign
Transcript: ENSMUST00000014996
AA Change: P60L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000014996
Gene: ENSMUSG00000014852
AA Change: P60L

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Reprolysin_4	84	287	2.3e-11	PFAM
Pfam:Reprolysin	84	291	1e-15	PFAM
Pfam:Reprolysin_3	113	237	2e-10	PFAM
Pfam:Reprolysin_2	132	281	5e-9	PFAM
TSP1	392	444	3.29e-14	SMART
TSP1	693	748	7.01e0	SMART
TSP1	750	810	3.34e-6	SMART
TSP1	904	959	5.85e0	SMART
TSP1	961	1019	2.69e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102891
AA Change: P60L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000099955
Gene: ENSMUSG00000014852
AA Change: P60L

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Reprolysin_4	84	287	8.5e-11	PFAM
Pfam:Reprolysin	96	291	4.9e-14	PFAM
Pfam:Reprolysin_3	106	237	5.6e-11	PFAM
TSP1	392	444	3.29e-14	SMART
TSP1	693	748	7.01e0	SMART
TSP1	750	810	3.34e-6	SMART
TSP1	904	959	5.85e0	SMART
TSP1	961	1019	2.69e0	SMART
Blast:TSP1	1022	1079	4e-26	BLAST
TSP1	1081	1137	4.58e-4	SMART
Blast:CUB	1196	1293	2e-39	BLAST
Blast:CUB	1303	1412	3e-63	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. In certain mouse strains (C57BL/6, for example) an intracisternal A-type particle (IAP) retrotransposon sequence is located in the intron 23 that causes an alternate splicing event resulting in a shorter transcript variants encoding shorter isoforms. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme that cleaves von Willebrand factor (VWF) in circulating blood. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,741,456	S559P	probably benign	Het
A430005L14Rik	T	A	4: 153,959,857	C42S	probably damaging	Het
Abca13	A	T	11: 9,273,967	T449S	probably benign	Het
Acvr1c	T	A	2: 58,315,975	Q41L	probably benign	Het
Adamts20	T	C	15: 94,347,718	T568A	possibly damaging	Het
Ago1	T	C	4: 126,454,394	I44V	probably null	Het
Agtpbp1	TGAAGATGCATCTTGAGAAGA	TGAAGA	13: 59,475,803		probably null	Het
Ankrd28	A	T	14: 31,745,336	V39E	possibly damaging	Het
Apaf1	A	G	10: 91,061,814	V269A	possibly damaging	Het
Asna1	T	C	8: 85,025,160	S36G	probably damaging	Het
Astn1	A	G	1: 158,520,521	N506D	probably damaging	Het
BC051019	G	A	7: 109,720,551	Q102*	probably null	Het
Bpifb5	A	G	2: 154,233,279	T376A	possibly damaging	Het
Ccdc121	G	T	1: 181,510,986	Q134K	probably benign	Het
Ccl20	ATT	ATTT	1: 83,117,855		probably null	Het
Ccl6	G	T	11: 83,589,337	P68T	possibly damaging	Het
Cd300ld	A	T	11: 114,987,330	F119I	probably benign	Het
Cdk2ap2	A	G	19: 4,097,903	M57V	possibly damaging	Het
Chkb	C	T	15: 89,428,766	G36E	probably damaging	Het
Col11a1	A	G	3: 114,165,293		probably null	Het
Ctla2b	T	C	13: 60,896,067	Y120C	probably damaging	Het
Ctnnd1	T	C	2: 84,620,360	N172S	probably benign	Het
Cyp2a22	G	A	7: 26,934,772	P319L	probably damaging	Het
Dcaf12	A	C	4: 41,302,804	V117G	probably damaging	Het
Ddx6	A	G	9: 44,607,534	T48A	probably benign	Het
Dgki	T	C	6: 36,865,801	D923G	possibly damaging	Het
Dhx37	G	T	5: 125,427,464	T345K	probably damaging	Het
Dhx9	A	T	1: 153,456,111	Y1370*	probably null	Het
Dnah7b	T	C	1: 46,142,087	S1045P	possibly damaging	Het
Dnmbp	G	C	19: 43,850,173	T1071S	possibly damaging	Het
Dspp	T	A	5: 104,178,559	S929R	unknown	Het
Dst	A	T	1: 34,184,063	E1625D	probably damaging	Het
Egflam	T	A	15: 7,242,567	H630L	probably benign	Het
Elane	T	C	10: 79,887,759	V186A	possibly damaging	Het
Fam209	C	A	2: 172,472,769	N59K	probably benign	Het
Gbe1	A	G	16: 70,528,926	E617G	probably damaging	Het
Gfra1	A	G	19: 58,300,275	L246P	probably damaging	Het
Gm14139	T	A	2: 150,192,947	M396K	probably benign	Het
Gria2	T	C	3: 80,710,805	T308A	probably benign	Het
Grip2	A	T	6: 91,779,850	V540D	probably benign	Het
Hhipl1	A	T	12: 108,321,859	I575F	possibly damaging	Het
Hmcn1	T	A	1: 150,738,613	E1347D	possibly damaging	Het
Itga2b	C	A	11: 102,467,339	A187S	probably benign	Het
Kalrn	C	A	16: 34,028,045	R469M	probably damaging	Het
Kif23	A	T	9: 61,927,384	C426*	probably null	Het
Lck	T	C	4: 129,548,937	N475S	probably benign	Het
Leng8	A	G	7: 4,145,074	N642S	probably damaging	Het
Lingo4	T	A	3: 94,403,075	I440N	probably damaging	Het
Lrrc4	A	G	6: 28,830,905	F237S	probably damaging	Het
Magel2	G	A	7: 62,379,096	V583I	unknown	Het
Naip2	A	T	13: 100,144,588	I1316N	probably damaging	Het
Naip6	C	T	13: 100,300,729	G429S	probably benign	Het
Noct	C	T	3: 51,248,044	R78C	probably damaging	Het
Npbwr1	A	G	1: 5,917,175	V40A	possibly damaging	Het
Nsd2	A	G	5: 33,843,402	N88D	probably damaging	Het
Olfr1020	T	A	2: 85,850,400	V316E	probably benign	Het
Olfr1066	T	C	2: 86,455,473	H266R	probably benign	Het
Olfr389	T	A	11: 73,776,713	I205F	probably benign	Het
Olfr800	T	A	10: 129,660,421	I205N	probably benign	Het
Pak7	T	A	2: 136,116,637	H177L	probably benign	Het
Pard3	C	T	8: 127,064,347		probably null	Het
Pde4c	A	G	8: 70,747,358		probably null	Het
Pde6h	T	A	6: 136,963,205	I63N	probably damaging	Het
Phldb2	T	C	16: 45,774,195	K916E	possibly damaging	Het
Ppig	T	C	2: 69,741,644	S236P	unknown	Het
Ptprd	T	C	4: 75,954,122	Y1370C	probably damaging	Het
Pzp	T	C	6: 128,516,120	T352A	probably benign	Het
Rab3gap1	A	G	1: 127,903,719	Y177C	possibly damaging	Het
Rasgef1a	G	A	6: 118,089,196	V457M	probably benign	Het
Scel	A	T	14: 103,610,790	T616S	possibly damaging	Het
Sel1l	A	T	12: 91,826,550	Y228*	probably null	Het
Sgms1	A	G	19: 32,159,683	V161A	possibly damaging	Het
Slfnl1	T	C	4: 120,533,227	L25P	probably benign	Het
Smad5	A	G	13: 56,737,374	T432A	probably damaging	Het
Sohlh2	T	C	3: 55,192,341		probably null	Het
Sphkap	A	T	1: 83,276,662	M835K	probably damaging	Het
Sqor	A	C	2: 122,798,098	T174P	probably damaging	Het
Stkld1	T	C	2: 26,952,747	V577A	probably damaging	Het
Sulf2	T	A	2: 166,080,853	E652D	probably benign	Het
Sycp2	T	A	2: 178,378,055	Q556L	probably benign	Het
Syk	A	G	13: 52,611,238	T134A	probably benign	Het
Tas2r122	T	A	6: 132,711,622	I103F	possibly damaging	Het
Tex10	A	G	4: 48,451,940	W729R	probably damaging	Het
Tex261	G	T	6: 83,773,731	P95T	probably damaging	Het
Tm2d2	T	C	8: 25,017,507	S47P	probably benign	Het
Tmem2	A	G	19: 21,801,987	D387G	probably benign	Het
Tmem95	A	G	11: 69,876,991	S128P	probably damaging	Het
Tnxb	G	A	17: 34,692,579	A1619T	possibly damaging	Het
Trappc9	A	G	15: 73,058,036	I157T	probably damaging	Het
Unc13c	T	A	9: 73,483,615		probably null	Het
Upb1	A	T	10: 75,429,969	Y210F	probably damaging	Het
Urb1	T	C	16: 90,762,344	M1684V	probably benign	Het
Wnk2	G	A	13: 49,078,682	P727S	possibly damaging	Het
Zfp551	A	T	7: 12,416,349	S378T	probably damaging	Het
Zfp598	T	C	17: 24,669,924	V56A	possibly damaging	Het
Zfp945	C	T	17: 22,857,249		probably null	Het

Other mutations in Adamts13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Adamts13	APN	2	27005361	missense	probably benign	0.04
IGL00465:Adamts13	APN	2	26973555	missense	probably benign	0.32
IGL01114:Adamts13	APN	2	27005190	missense	probably benign	0.41
IGL01138:Adamts13	APN	2	26983042	missense	probably damaging	1.00
IGL01154:Adamts13	APN	2	27006194	missense	probably benign
IGL01860:Adamts13	APN	2	26978011	missense	probably damaging	0.99
IGL01924:Adamts13	APN	2	26996583	missense	possibly damaging	0.80
IGL01991:Adamts13	APN	2	26990598	missense	probably damaging	0.97
IGL02215:Adamts13	APN	2	26985483	missense	probably damaging	1.00
IGL02415:Adamts13	APN	2	26989283	missense	possibly damaging	0.95
IGL02519:Adamts13	APN	2	26978675	missense	probably damaging	1.00
IGL02956:Adamts13	APN	2	26983037	missense	probably benign	0.18
IGL03209:Adamts13	APN	2	26992961	missense	probably benign	0.00
I1329:Adamts13	UTSW	2	26973619	missense	possibly damaging	0.52
IGL02837:Adamts13	UTSW	2	26991420	missense	probably benign	0.01
IGL03048:Adamts13	UTSW	2	26978699	critical splice donor site	probably null
R0041:Adamts13	UTSW	2	26983974	missense	probably damaging	1.00
R0217:Adamts13	UTSW	2	26996921	splice site	probably benign
R0276:Adamts13	UTSW	2	26975760	missense	possibly damaging	0.91
R0309:Adamts13	UTSW	2	26986989	missense	probably damaging	0.99
R0348:Adamts13	UTSW	2	26981080	missense	probably benign	0.13
R0369:Adamts13	UTSW	2	27005186	missense	probably benign	0.00
R0386:Adamts13	UTSW	2	26986679	splice site	probably null
R0553:Adamts13	UTSW	2	26991334	nonsense	probably null
R0714:Adamts13	UTSW	2	26986985	splice site	probably benign
R0862:Adamts13	UTSW	2	27006324	critical splice donor site	probably null
R1320:Adamts13	UTSW	2	26989246	missense	probably damaging	0.97
R1458:Adamts13	UTSW	2	26988354	missense	probably damaging	1.00
R1473:Adamts13	UTSW	2	26981753	nonsense	probably null
R1491:Adamts13	UTSW	2	26978315	missense	probably damaging	1.00
R1588:Adamts13	UTSW	2	26975675	missense	probably benign	0.01
R1638:Adamts13	UTSW	2	26996583	missense	possibly damaging	0.80
R1724:Adamts13	UTSW	2	26991294	missense	probably benign	0.00
R1924:Adamts13	UTSW	2	26984141	missense	probably damaging	1.00
R2072:Adamts13	UTSW	2	27005425	missense	probably benign	0.10
R2073:Adamts13	UTSW	2	27006314	missense	probably damaging	1.00
R2409:Adamts13	UTSW	2	26978362	missense	probably benign	0.00
R4362:Adamts13	UTSW	2	27004782	missense	probably damaging	1.00
R4363:Adamts13	UTSW	2	27004782	missense	probably damaging	1.00
R4422:Adamts13	UTSW	2	27005400	missense	probably benign	0.00
R4769:Adamts13	UTSW	2	27008711	nonsense	probably null
R4785:Adamts13	UTSW	2	26983042	missense	probably damaging	1.00
R4831:Adamts13	UTSW	2	26983130	critical splice donor site	probably null
R4832:Adamts13	UTSW	2	26989402	missense	probably benign	0.22
R4945:Adamts13	UTSW	2	26986610	missense	probably damaging	1.00
R5047:Adamts13	UTSW	2	26996910	missense	probably damaging	0.98
R5126:Adamts13	UTSW	2	26996915	critical splice donor site	probably null
R5161:Adamts13	UTSW	2	26993008	missense	probably benign	0.00
R5394:Adamts13	UTSW	2	26986558	missense	probably benign	0.00
R5557:Adamts13	UTSW	2	26973639	missense	probably benign	0.05
R5660:Adamts13	UTSW	2	26996749	missense	probably benign
R5890:Adamts13	UTSW	2	26986591	missense	probably damaging	0.96
R6168:Adamts13	UTSW	2	27004886	missense	probably benign	0.37
R6536:Adamts13	UTSW	2	26975750	missense	probably damaging	0.99
R6929:Adamts13	UTSW	2	27006263	nonsense	probably null
R7207:Adamts13	UTSW	2	26978695	missense	probably damaging	1.00
R7211:Adamts13	UTSW	2	26989298	missense	probably benign	0.40
R7212:Adamts13	UTSW	2	27006314	missense	probably damaging	1.00
R7392:Adamts13	UTSW	2	26989324	missense	probably damaging	1.00
R7583:Adamts13	UTSW	2	26973953	missense	probably benign
R7604:Adamts13	UTSW	2	27005206	missense	probably benign	0.00
R7783:Adamts13	UTSW	2	26990585	missense	not run
R7814:Adamts13	UTSW	2	26996549	missense	probably benign
R8076:Adamts13	UTSW	2	26990612	missense	probably benign	0.06
R8245:Adamts13	UTSW	2	26990556	missense	probably damaging	1.00
R8526:Adamts13	UTSW	2	26978000	missense	probably benign
R9112:Adamts13	UTSW	2	26990367	missense	possibly damaging	0.60
R9147:Adamts13	UTSW	2	26993012	missense	probably benign
R9148:Adamts13	UTSW	2	26993012	missense	probably benign
R9704:Adamts13	UTSW	2	27005225	missense
R9743:Adamts13	UTSW	2	26996800	missense	probably benign	0.16
R9743:Adamts13	UTSW	2	27005479	critical splice donor site	probably null
X0027:Adamts13	UTSW	2	26985546	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGACTGATCTTCCCTGCCTAG -3'
(R):5'- TGTGACGCTGAACAGAAGC -3'

Sequencing Primer
(F):5'- GGCACTGCCCCTCATGC -3'
(R):5'- CTATTATCAAGTTGGCAGGAAGC -3'

Posted On

2014-08-25