Incidental Mutation 'R2001:4932414N04Rik'
Institutional Source Beutler Lab
Gene Symbol 4932414N04Rik
Ensembl Gene ENSMUSG00000079324
Gene NameRIKEN cDNA 4932414N04 gene
MMRRC Submission 040011-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2001 (G1)
Quality Score225
Status Not validated
Chromosomal Location68656486-68748467 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68741456 bp
Amino Acid Change Serine to Proline at position 559 (S559P)
Ref Sequence ENSEMBL: ENSMUSP00000135792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055930] [ENSMUST00000128259]
Predicted Effect probably benign
Transcript: ENSMUST00000055930
AA Change: S559P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059809
Gene: ENSMUSG00000079324
AA Change: S559P

coiled coil region 154 241 N/A INTRINSIC
Pfam:DUF3496 265 361 8.5e-12 PFAM
internal_repeat_1 456 597 1.76e-26 PROSPERO
internal_repeat_1 601 737 1.76e-26 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000128259
AA Change: S559P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135792
Gene: ENSMUSG00000079324
AA Change: S559P

internal_repeat_1 5 39 6.02e-5 PROSPERO
internal_repeat_1 209 242 6.02e-5 PROSPERO
low complexity region 286 297 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430005L14Rik T A 4: 153,959,857 C42S probably damaging Het
Abca13 A T 11: 9,273,967 T449S probably benign Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Adamts13 C T 2: 26,973,990 P60L probably benign Het
Adamts20 T C 15: 94,347,718 T568A possibly damaging Het
Ago1 T C 4: 126,454,394 I44V probably null Het
Agtpbp1 TGAAGATGCATCTTGAGAAGA TGAAGA 13: 59,475,803 probably null Het
Ankrd28 A T 14: 31,745,336 V39E possibly damaging Het
Apaf1 A G 10: 91,061,814 V269A possibly damaging Het
Asna1 T C 8: 85,025,160 S36G probably damaging Het
Astn1 A G 1: 158,520,521 N506D probably damaging Het
BC051019 G A 7: 109,720,551 Q102* probably null Het
Bpifb5 A G 2: 154,233,279 T376A possibly damaging Het
Ccdc121 G T 1: 181,510,986 Q134K probably benign Het
Ccl20 ATT ATTT 1: 83,117,855 probably null Het
Ccl6 G T 11: 83,589,337 P68T possibly damaging Het
Cd300ld A T 11: 114,987,330 F119I probably benign Het
Cdk2ap2 A G 19: 4,097,903 M57V possibly damaging Het
Chkb C T 15: 89,428,766 G36E probably damaging Het
Col11a1 A G 3: 114,165,293 probably null Het
Ctla2b T C 13: 60,896,067 Y120C probably damaging Het
Ctnnd1 T C 2: 84,620,360 N172S probably benign Het
Cyp2a22 G A 7: 26,934,772 P319L probably damaging Het
Dcaf12 A C 4: 41,302,804 V117G probably damaging Het
Ddx6 A G 9: 44,607,534 T48A probably benign Het
Dgki T C 6: 36,865,801 D923G possibly damaging Het
Dhx37 G T 5: 125,427,464 T345K probably damaging Het
Dhx9 A T 1: 153,456,111 Y1370* probably null Het
Dnah7b T C 1: 46,142,087 S1045P possibly damaging Het
Dnmbp G C 19: 43,850,173 T1071S possibly damaging Het
Dspp T A 5: 104,178,559 S929R unknown Het
Dst A T 1: 34,184,063 E1625D probably damaging Het
Egflam T A 15: 7,242,567 H630L probably benign Het
Elane T C 10: 79,887,759 V186A possibly damaging Het
Fam209 C A 2: 172,472,769 N59K probably benign Het
Gbe1 A G 16: 70,528,926 E617G probably damaging Het
Gfra1 A G 19: 58,300,275 L246P probably damaging Het
Gm14139 T A 2: 150,192,947 M396K probably benign Het
Gria2 T C 3: 80,710,805 T308A probably benign Het
Grip2 A T 6: 91,779,850 V540D probably benign Het
Hhipl1 A T 12: 108,321,859 I575F possibly damaging Het
Hmcn1 T A 1: 150,738,613 E1347D possibly damaging Het
Itga2b C A 11: 102,467,339 A187S probably benign Het
Kalrn C A 16: 34,028,045 R469M probably damaging Het
Kif23 A T 9: 61,927,384 C426* probably null Het
Lck T C 4: 129,548,937 N475S probably benign Het
Leng8 A G 7: 4,145,074 N642S probably damaging Het
Lingo4 T A 3: 94,403,075 I440N probably damaging Het
Lrrc4 A G 6: 28,830,905 F237S probably damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Naip2 A T 13: 100,144,588 I1316N probably damaging Het
Naip6 C T 13: 100,300,729 G429S probably benign Het
Noct C T 3: 51,248,044 R78C probably damaging Het
Npbwr1 A G 1: 5,917,175 V40A possibly damaging Het
Nsd2 A G 5: 33,843,402 N88D probably damaging Het
Olfr1020 T A 2: 85,850,400 V316E probably benign Het
Olfr1066 T C 2: 86,455,473 H266R probably benign Het
Olfr389 T A 11: 73,776,713 I205F probably benign Het
Olfr800 T A 10: 129,660,421 I205N probably benign Het
Pak7 T A 2: 136,116,637 H177L probably benign Het
Pard3 C T 8: 127,064,347 probably null Het
Pde4c A G 8: 70,747,358 probably null Het
Pde6h T A 6: 136,963,205 I63N probably damaging Het
Phldb2 T C 16: 45,774,195 K916E possibly damaging Het
Ppig T C 2: 69,741,644 S236P unknown Het
Ptprd T C 4: 75,954,122 Y1370C probably damaging Het
Pzp T C 6: 128,516,120 T352A probably benign Het
Rab3gap1 A G 1: 127,903,719 Y177C possibly damaging Het
Rasgef1a G A 6: 118,089,196 V457M probably benign Het
Scel A T 14: 103,610,790 T616S possibly damaging Het
Sel1l A T 12: 91,826,550 Y228* probably null Het
Sgms1 A G 19: 32,159,683 V161A possibly damaging Het
Slfnl1 T C 4: 120,533,227 L25P probably benign Het
Smad5 A G 13: 56,737,374 T432A probably damaging Het
Sohlh2 T C 3: 55,192,341 probably null Het
Sphkap A T 1: 83,276,662 M835K probably damaging Het
Sqor A C 2: 122,798,098 T174P probably damaging Het
Stkld1 T C 2: 26,952,747 V577A probably damaging Het
Sulf2 T A 2: 166,080,853 E652D probably benign Het
Sycp2 T A 2: 178,378,055 Q556L probably benign Het
Syk A G 13: 52,611,238 T134A probably benign Het
Tas2r122 T A 6: 132,711,622 I103F possibly damaging Het
Tex10 A G 4: 48,451,940 W729R probably damaging Het
Tex261 G T 6: 83,773,731 P95T probably damaging Het
Tm2d2 T C 8: 25,017,507 S47P probably benign Het
Tmem2 A G 19: 21,801,987 D387G probably benign Het
Tmem95 A G 11: 69,876,991 S128P probably damaging Het
Tnxb G A 17: 34,692,579 A1619T possibly damaging Het
Trappc9 A G 15: 73,058,036 I157T probably damaging Het
Unc13c T A 9: 73,483,615 probably null Het
Upb1 A T 10: 75,429,969 Y210F probably damaging Het
Urb1 T C 16: 90,762,344 M1684V probably benign Het
Wnk2 G A 13: 49,078,682 P727S possibly damaging Het
Zfp551 A T 7: 12,416,349 S378T probably damaging Het
Zfp598 T C 17: 24,669,924 V56A possibly damaging Het
Zfp945 C T 17: 22,857,249 probably null Het
Other mutations in 4932414N04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:4932414N04Rik APN 2 68732875 missense probably benign 0.02
IGL01384:4932414N04Rik APN 2 68745405 missense possibly damaging 0.53
IGL02170:4932414N04Rik APN 2 68731123 missense probably benign 0.02
IGL02650:4932414N04Rik APN 2 68741537 missense probably benign 0.00
IGL02707:4932414N04Rik APN 2 68731130 missense possibly damaging 0.71
IGL02737:4932414N04Rik APN 2 68736560 missense possibly damaging 0.53
IGL03351:4932414N04Rik APN 2 68731083 missense probably benign
R0328:4932414N04Rik UTSW 2 68744280 missense possibly damaging 0.53
R0362:4932414N04Rik UTSW 2 68732917 missense probably benign 0.00
R0638:4932414N04Rik UTSW 2 68717228 missense probably benign 0.18
R1201:4932414N04Rik UTSW 2 68716282 missense possibly damaging 0.53
R1381:4932414N04Rik UTSW 2 68731086 missense probably benign 0.18
R1456:4932414N04Rik UTSW 2 68716214 missense possibly damaging 0.86
R2051:4932414N04Rik UTSW 2 68711048 missense possibly damaging 0.72
R2228:4932414N04Rik UTSW 2 68729591 missense probably benign 0.00
R2292:4932414N04Rik UTSW 2 68732139 missense probably benign 0.00
R2357:4932414N04Rik UTSW 2 68739500 missense possibly damaging 0.86
R2484:4932414N04Rik UTSW 2 68711475 missense possibly damaging 0.85
R3035:4932414N04Rik UTSW 2 68745418 missense probably benign 0.00
R3916:4932414N04Rik UTSW 2 68731985 missense possibly damaging 0.71
R3950:4932414N04Rik UTSW 2 68664403 critical splice donor site probably null
R3951:4932414N04Rik UTSW 2 68664403 critical splice donor site probably null
R3952:4932414N04Rik UTSW 2 68664403 critical splice donor site probably null
R4091:4932414N04Rik UTSW 2 68745378 missense possibly damaging 0.73
R4118:4932414N04Rik UTSW 2 68736513 missense probably benign
R4153:4932414N04Rik UTSW 2 68668597 intron probably benign
R4210:4932414N04Rik UTSW 2 68659878 start gained probably benign
R4614:4932414N04Rik UTSW 2 68745460 missense probably benign 0.01
R4818:4932414N04Rik UTSW 2 68741466 missense probably benign
R5202:4932414N04Rik UTSW 2 68731964 missense probably benign
R5466:4932414N04Rik UTSW 2 68711389 missense probably benign 0.11
R5585:4932414N04Rik UTSW 2 68741426 missense probably benign 0.00
R5602:4932414N04Rik UTSW 2 68748368 makesense probably null
R5846:4932414N04Rik UTSW 2 68732033 missense unknown
R5902:4932414N04Rik UTSW 2 68708937 start codon destroyed probably null
R6002:4932414N04Rik UTSW 2 68662424 splice site probably null
R6029:4932414N04Rik UTSW 2 68694026 splice site probably null
R6093:4932414N04Rik UTSW 2 68659870 splice site probably benign
R6168:4932414N04Rik UTSW 2 68741483 missense possibly damaging 0.86
R6300:4932414N04Rik UTSW 2 68731109 missense possibly damaging 0.96
R6322:4932414N04Rik UTSW 2 68729499 missense probably benign 0.00
R6533:4932414N04Rik UTSW 2 68716318 nonsense probably null
R6547:4932414N04Rik UTSW 2 68659907 utr 5 prime probably benign
R7309:4932414N04Rik UTSW 2 68716186 missense probably benign 0.29
R7400:4932414N04Rik UTSW 2 68666203 missense unknown
R7454:4932414N04Rik UTSW 2 68688304 missense unknown
R7481:4932414N04Rik UTSW 2 68664231 missense unknown
R7498:4932414N04Rik UTSW 2 68667668 missense unknown
R7523:4932414N04Rik UTSW 2 68662480 missense unknown
R7523:4932414N04Rik UTSW 2 68739329 missense probably benign 0.01
R7583:4932414N04Rik UTSW 2 68739326 missense probably damaging 0.98
R7701:4932414N04Rik UTSW 2 68731204 missense possibly damaging 0.60
R7746:4932414N04Rik UTSW 2 68728995 missense probably benign 0.33
R7778:4932414N04Rik UTSW 2 68739511 missense possibly damaging 0.73
X0025:4932414N04Rik UTSW 2 68729016 missense probably benign 0.06
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-08-25