Mutagenetix > Incidental Mutations

Incidental Mutation 'R2001:Gria2'

225906

Institutional Source

Beutler Lab

Gene Symbol

Gria2

Ensembl Gene

ENSMUSG00000033981

Gene Name

glutamate receptor, ionotropic, AMPA2 (alpha 2)

Synonyms

Glur2, Glur-2, GluR-B, GluA2, GluR2

MMRRC Submission

040011-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.528) question?

Stock #

R2001 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80681450-80802835 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80710805 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 308 (T308A)

Ref Sequence

ENSEMBL: ENSMUSP00000141447 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075316] [ENSMUST00000107745] [ENSMUST00000192463]

Predicted Effect

probably benign
Transcript: ENSMUST00000075316
AA Change: T308A

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000074787
Gene: ENSMUSG00000033981
AA Change: T308A

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	49	379	2.7e-58	PFAM
PBPe	415	790	3.75e-132	SMART
Lig_chan-Glu_bd	425	490	2.96e-31	SMART
low complexity region	820	832	N/A	INTRINSIC
low complexity region	853	865	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107745
AA Change: T308A

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000103374
Gene: ENSMUSG00000033981
AA Change: T308A

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	47	379	4.8e-53	PFAM
PBPe	415	790	8.16e-133	SMART
Lig_chan-Glu_bd	425	490	2.96e-31	SMART
low complexity region	820	832	N/A	INTRINSIC
low complexity region	853	865	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192463
AA Change: T308A

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000141447
Gene: ENSMUSG00000033981
AA Change: T308A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	47	379	1.7e-51	PFAM
PBPe	415	770	1.2e-105	SMART
Lig_chan-Glu_bd	425	490	2.2e-35	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193645

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194383

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195062

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to a family of glutamate receptors that are sensitive to alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA), and function as ligand-activated cation channels. These channels are assembled from 4 related subunits, Gria1-4. The subunit encoded by this gene (Gria2) is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to render the channel impermeable to Ca(2+). Alternative splicing, resulting in transcript variants encoding different isoforms, (including the flip and flop isoforms that vary in their signal transduction properties), has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit epilepsy, deficient dendritic architecture, altered exploratory behavior, impaired motor and learning performance, and increased mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,741,456	S559P	probably benign	Het
A430005L14Rik	T	A	4: 153,959,857	C42S	probably damaging	Het
Abca13	A	T	11: 9,273,967	T449S	probably benign	Het
Acvr1c	T	A	2: 58,315,975	Q41L	probably benign	Het
Adamts13	C	T	2: 26,973,990	P60L	probably benign	Het
Adamts20	T	C	15: 94,347,718	T568A	possibly damaging	Het
Ago1	T	C	4: 126,454,394	I44V	probably null	Het
Agtpbp1	TGAAGATGCATCTTGAGAAGA	TGAAGA	13: 59,475,803		probably null	Het
Ankrd28	A	T	14: 31,745,336	V39E	possibly damaging	Het
Apaf1	A	G	10: 91,061,814	V269A	possibly damaging	Het
Asna1	T	C	8: 85,025,160	S36G	probably damaging	Het
Astn1	A	G	1: 158,520,521	N506D	probably damaging	Het
BC051019	G	A	7: 109,720,551	Q102*	probably null	Het
Bpifb5	A	G	2: 154,233,279	T376A	possibly damaging	Het
Ccdc121	G	T	1: 181,510,986	Q134K	probably benign	Het
Ccl20	ATT	ATTT	1: 83,117,855		probably null	Het
Ccl6	G	T	11: 83,589,337	P68T	possibly damaging	Het
Cd300ld	A	T	11: 114,987,330	F119I	probably benign	Het
Cdk2ap2	A	G	19: 4,097,903	M57V	possibly damaging	Het
Chkb	C	T	15: 89,428,766	G36E	probably damaging	Het
Col11a1	A	G	3: 114,165,293		probably null	Het
Ctla2b	T	C	13: 60,896,067	Y120C	probably damaging	Het
Ctnnd1	T	C	2: 84,620,360	N172S	probably benign	Het
Cyp2a22	G	A	7: 26,934,772	P319L	probably damaging	Het
Dcaf12	A	C	4: 41,302,804	V117G	probably damaging	Het
Ddx6	A	G	9: 44,607,534	T48A	probably benign	Het
Dgki	T	C	6: 36,865,801	D923G	possibly damaging	Het
Dhx37	G	T	5: 125,427,464	T345K	probably damaging	Het
Dhx9	A	T	1: 153,456,111	Y1370*	probably null	Het
Dnah7b	T	C	1: 46,142,087	S1045P	possibly damaging	Het
Dnmbp	G	C	19: 43,850,173	T1071S	possibly damaging	Het
Dspp	T	A	5: 104,178,559	S929R	unknown	Het
Dst	A	T	1: 34,184,063	E1625D	probably damaging	Het
Egflam	T	A	15: 7,242,567	H630L	probably benign	Het
Elane	T	C	10: 79,887,759	V186A	possibly damaging	Het
Fam209	C	A	2: 172,472,769	N59K	probably benign	Het
Gbe1	A	G	16: 70,528,926	E617G	probably damaging	Het
Gfra1	A	G	19: 58,300,275	L246P	probably damaging	Het
Gm14139	T	A	2: 150,192,947	M396K	probably benign	Het
Grip2	A	T	6: 91,779,850	V540D	probably benign	Het
Hhipl1	A	T	12: 108,321,859	I575F	possibly damaging	Het
Hmcn1	T	A	1: 150,738,613	E1347D	possibly damaging	Het
Itga2b	C	A	11: 102,467,339	A187S	probably benign	Het
Kalrn	C	A	16: 34,028,045	R469M	probably damaging	Het
Kif23	A	T	9: 61,927,384	C426*	probably null	Het
Lck	T	C	4: 129,548,937	N475S	probably benign	Het
Leng8	A	G	7: 4,145,074	N642S	probably damaging	Het
Lingo4	T	A	3: 94,403,075	I440N	probably damaging	Het
Lrrc4	A	G	6: 28,830,905	F237S	probably damaging	Het
Magel2	G	A	7: 62,379,096	V583I	unknown	Het
Naip2	A	T	13: 100,144,588	I1316N	probably damaging	Het
Naip6	C	T	13: 100,300,729	G429S	probably benign	Het
Noct	C	T	3: 51,248,044	R78C	probably damaging	Het
Npbwr1	A	G	1: 5,917,175	V40A	possibly damaging	Het
Nsd2	A	G	5: 33,843,402	N88D	probably damaging	Het
Olfr1020	T	A	2: 85,850,400	V316E	probably benign	Het
Olfr1066	T	C	2: 86,455,473	H266R	probably benign	Het
Olfr389	T	A	11: 73,776,713	I205F	probably benign	Het
Olfr800	T	A	10: 129,660,421	I205N	probably benign	Het
Pak7	T	A	2: 136,116,637	H177L	probably benign	Het
Pard3	C	T	8: 127,064,347		probably null	Het
Pde4c	A	G	8: 70,747,358		probably null	Het
Pde6h	T	A	6: 136,963,205	I63N	probably damaging	Het
Phldb2	T	C	16: 45,774,195	K916E	possibly damaging	Het
Ppig	T	C	2: 69,741,644	S236P	unknown	Het
Ptprd	T	C	4: 75,954,122	Y1370C	probably damaging	Het
Pzp	T	C	6: 128,516,120	T352A	probably benign	Het
Rab3gap1	A	G	1: 127,903,719	Y177C	possibly damaging	Het
Rasgef1a	G	A	6: 118,089,196	V457M	probably benign	Het
Scel	A	T	14: 103,610,790	T616S	possibly damaging	Het
Sel1l	A	T	12: 91,826,550	Y228*	probably null	Het
Sgms1	A	G	19: 32,159,683	V161A	possibly damaging	Het
Slfnl1	T	C	4: 120,533,227	L25P	probably benign	Het
Smad5	A	G	13: 56,737,374	T432A	probably damaging	Het
Sohlh2	T	C	3: 55,192,341		probably null	Het
Sphkap	A	T	1: 83,276,662	M835K	probably damaging	Het
Sqor	A	C	2: 122,798,098	T174P	probably damaging	Het
Stkld1	T	C	2: 26,952,747	V577A	probably damaging	Het
Sulf2	T	A	2: 166,080,853	E652D	probably benign	Het
Sycp2	T	A	2: 178,378,055	Q556L	probably benign	Het
Syk	A	G	13: 52,611,238	T134A	probably benign	Het
Tas2r122	T	A	6: 132,711,622	I103F	possibly damaging	Het
Tex10	A	G	4: 48,451,940	W729R	probably damaging	Het
Tex261	G	T	6: 83,773,731	P95T	probably damaging	Het
Tm2d2	T	C	8: 25,017,507	S47P	probably benign	Het
Tmem2	A	G	19: 21,801,987	D387G	probably benign	Het
Tmem95	A	G	11: 69,876,991	S128P	probably damaging	Het
Tnxb	G	A	17: 34,692,579	A1619T	possibly damaging	Het
Trappc9	A	G	15: 73,058,036	I157T	probably damaging	Het
Unc13c	T	A	9: 73,483,615		probably null	Het
Upb1	A	T	10: 75,429,969	Y210F	probably damaging	Het
Urb1	T	C	16: 90,762,344	M1684V	probably benign	Het
Wnk2	G	A	13: 49,078,682	P727S	possibly damaging	Het
Zfp551	A	T	7: 12,416,349	S378T	probably damaging	Het
Zfp598	T	C	17: 24,669,924	V56A	possibly damaging	Het
Zfp945	C	T	17: 22,857,249		probably null	Het

Other mutations in Gria2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00796:Gria2	APN	3	80710790	missense	probably benign	0.12
IGL00832:Gria2	APN	3	80707251	missense	probably damaging	1.00
IGL01086:Gria2	APN	3	80692381	missense	probably damaging	1.00
IGL01409:Gria2	APN	3	80707697	critical splice donor site	probably null
IGL01924:Gria2	APN	3	80710331	missense	probably benign	0.13
IGL01999:Gria2	APN	3	80732091	missense	probably damaging	1.00
IGL02355:Gria2	APN	3	80706937	missense	probably damaging	1.00
IGL02362:Gria2	APN	3	80706937	missense	probably damaging	1.00
IGL02389:Gria2	APN	3	80709422	missense	probably benign	0.14
IGL02444:Gria2	APN	3	80702553	missense	possibly damaging	0.65
IGL02532:Gria2	APN	3	80706999	missense	probably damaging	1.00
IGL02991:Gria2	UTSW	3	80707809	nonsense	probably null
R0015:Gria2	UTSW	3	80707767	missense	probably damaging	1.00
R0148:Gria2	UTSW	3	80707731	missense	probably damaging	1.00
R0201:Gria2	UTSW	3	80707838	missense	probably damaging	1.00
R0411:Gria2	UTSW	3	80710858	splice site	probably benign
R0551:Gria2	UTSW	3	80732026	splice site	probably benign
R0655:Gria2	UTSW	3	80732070	nonsense	probably null
R0866:Gria2	UTSW	3	80722024	splice site	probably benign
R1393:Gria2	UTSW	3	80707098	missense	probably damaging	1.00
R1458:Gria2	UTSW	3	80732045	missense	possibly damaging	0.71
R1563:Gria2	UTSW	3	80691397	missense	probably damaging	0.96
R1771:Gria2	UTSW	3	80692301	nonsense	probably null
R1775:Gria2	UTSW	3	80691338	missense	probably benign	0.09
R1902:Gria2	UTSW	3	80722108	missense	probably damaging	0.98
R1993:Gria2	UTSW	3	80802357	missense	probably benign
R1994:Gria2	UTSW	3	80802357	missense	probably benign
R1995:Gria2	UTSW	3	80802357	missense	probably benign
R2389:Gria2	UTSW	3	80702625	missense	probably damaging	1.00
R2520:Gria2	UTSW	3	80706962	missense	probably damaging	1.00
R2679:Gria2	UTSW	3	80740953	splice site	probably benign
R2865:Gria2	UTSW	3	80732085	missense	probably benign	0.00
R2869:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2869:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2870:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2870:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2871:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2871:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2872:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2872:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R3716:Gria2	UTSW	3	80741004	missense	possibly damaging	0.77
R3967:Gria2	UTSW	3	80710777	missense	possibly damaging	0.95
R4285:Gria2	UTSW	3	80707662	intron	probably benign
R4611:Gria2	UTSW	3	80692492	missense	probably damaging	0.99
R4612:Gria2	UTSW	3	80732051	missense	probably damaging	1.00
R4616:Gria2	UTSW	3	80706897	missense	probably damaging	1.00
R4706:Gria2	UTSW	3	80740990	missense	probably benign
R4996:Gria2	UTSW	3	80707141	missense	probably damaging	0.99
R5502:Gria2	UTSW	3	80706945	missense	probably damaging	1.00
R5930:Gria2	UTSW	3	80707249	missense	possibly damaging	0.91
R6142:Gria2	UTSW	3	80801717	missense	probably benign	0.13
R6233:Gria2	UTSW	3	80707203	missense	probably damaging	0.99
R6317:Gria2	UTSW	3	80741004	missense	possibly damaging	0.79
R6453:Gria2	UTSW	3	80740974	missense	possibly damaging	0.93
R6526:Gria2	UTSW	3	80692469	missense	probably damaging	1.00
R6545:Gria2	UTSW	3	80741144	missense	probably damaging	0.99
R6574:Gria2	UTSW	3	80689296	missense	probably damaging	0.99
R6720:Gria2	UTSW	3	80802304	missense	probably benign	0.37
R7009:Gria2	UTSW	3	80706972	missense	probably damaging	1.00
R7049:Gria2	UTSW	3	80689327	missense	probably damaging	0.99
R7191:Gria2	UTSW	3	80732085	missense	probably benign	0.24
R7225:Gria2	UTSW	3	80802631	unclassified	probably benign
R7374:Gria2	UTSW	3	80741076	missense	probably benign
R7837:Gria2	UTSW	3	80710788	missense	probably benign	0.18
R7920:Gria2	UTSW	3	80710788	missense	probably benign	0.18
R8034:Gria2	UTSW	3	80801699	missense	not run

Predicted Primers

PCR Primer
(F):5'- CTGTGTGAAGTCGCATCAGC -3'
(R):5'- GCATAGTCTCATTGTCCACATAC -3'

Sequencing Primer
(F):5'- GAAGTCGCATCAGCACTCATTCTG -3'
(R):5'- AGGAGCTGTGTTTAACTTCTTAGAGC -3'

Posted On

2014-08-25