Incidental Mutation 'R2001:Lingo4'
Institutional Source Beutler Lab
Gene Symbol Lingo4
Ensembl Gene ENSMUSG00000044505
Gene Nameleucine rich repeat and Ig domain containing 4
SynonymsLrrn6d, LERN4, A530050P17Rik
MMRRC Submission 040011-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R2001 (G1)
Quality Score225
Status Not validated
Chromosomal Location94398517-94404501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94403075 bp
Amino Acid Change Isoleucine to Asparagine at position 440 (I440N)
Ref Sequence ENSEMBL: ENSMUSP00000058050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050975] [ENSMUST00000197040]
Predicted Effect probably damaging
Transcript: ENSMUST00000050975
AA Change: I440N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058050
Gene: ENSMUSG00000044505
AA Change: I440N

LRRNT 55 89 1.23e-4 SMART
LRR 88 107 2.76e2 SMART
LRR_TYP 108 131 1.02e-6 SMART
LRR_TYP 132 155 7.26e-3 SMART
LRR 156 179 1.33e1 SMART
LRR_TYP 180 203 5.42e-2 SMART
LRR 204 227 4.45e1 SMART
LRR 228 251 3.27e1 SMART
LRR 300 323 4.83e0 SMART
LRR 324 347 3.07e-1 SMART
LRR 348 371 3.36e1 SMART
LRRCT 383 436 5.24e-5 SMART
IGc2 451 516 3.53e-13 SMART
transmembrane domain 560 582 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197040
SMART Domains Protein: ENSMUSP00000143763
Gene: ENSMUSG00000028150

ZnF_C4 7 78 7.2e-37 SMART
low complexity region 95 112 N/A INTRINSIC
HOLI 299 453 3.78e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198829
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,741,456 S559P probably benign Het
A430005L14Rik T A 4: 153,959,857 C42S probably damaging Het
Abca13 A T 11: 9,273,967 T449S probably benign Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Adamts13 C T 2: 26,973,990 P60L probably benign Het
Adamts20 T C 15: 94,347,718 T568A possibly damaging Het
Ago1 T C 4: 126,454,394 I44V probably null Het
Agtpbp1 TGAAGATGCATCTTGAGAAGA TGAAGA 13: 59,475,803 probably null Het
Ankrd28 A T 14: 31,745,336 V39E possibly damaging Het
Apaf1 A G 10: 91,061,814 V269A possibly damaging Het
Asna1 T C 8: 85,025,160 S36G probably damaging Het
Astn1 A G 1: 158,520,521 N506D probably damaging Het
BC051019 G A 7: 109,720,551 Q102* probably null Het
Bpifb5 A G 2: 154,233,279 T376A possibly damaging Het
Ccdc121 G T 1: 181,510,986 Q134K probably benign Het
Ccl20 ATT ATTT 1: 83,117,855 probably null Het
Ccl6 G T 11: 83,589,337 P68T possibly damaging Het
Cd300ld A T 11: 114,987,330 F119I probably benign Het
Cdk2ap2 A G 19: 4,097,903 M57V possibly damaging Het
Chkb C T 15: 89,428,766 G36E probably damaging Het
Col11a1 A G 3: 114,165,293 probably null Het
Ctla2b T C 13: 60,896,067 Y120C probably damaging Het
Ctnnd1 T C 2: 84,620,360 N172S probably benign Het
Cyp2a22 G A 7: 26,934,772 P319L probably damaging Het
Dcaf12 A C 4: 41,302,804 V117G probably damaging Het
Ddx6 A G 9: 44,607,534 T48A probably benign Het
Dgki T C 6: 36,865,801 D923G possibly damaging Het
Dhx37 G T 5: 125,427,464 T345K probably damaging Het
Dhx9 A T 1: 153,456,111 Y1370* probably null Het
Dnah7b T C 1: 46,142,087 S1045P possibly damaging Het
Dnmbp G C 19: 43,850,173 T1071S possibly damaging Het
Dspp T A 5: 104,178,559 S929R unknown Het
Dst A T 1: 34,184,063 E1625D probably damaging Het
Egflam T A 15: 7,242,567 H630L probably benign Het
Elane T C 10: 79,887,759 V186A possibly damaging Het
Fam209 C A 2: 172,472,769 N59K probably benign Het
Gbe1 A G 16: 70,528,926 E617G probably damaging Het
Gfra1 A G 19: 58,300,275 L246P probably damaging Het
Gm14139 T A 2: 150,192,947 M396K probably benign Het
Gria2 T C 3: 80,710,805 T308A probably benign Het
Grip2 A T 6: 91,779,850 V540D probably benign Het
Hhipl1 A T 12: 108,321,859 I575F possibly damaging Het
Hmcn1 T A 1: 150,738,613 E1347D possibly damaging Het
Itga2b C A 11: 102,467,339 A187S probably benign Het
Kalrn C A 16: 34,028,045 R469M probably damaging Het
Kif23 A T 9: 61,927,384 C426* probably null Het
Lck T C 4: 129,548,937 N475S probably benign Het
Leng8 A G 7: 4,145,074 N642S probably damaging Het
Lrrc4 A G 6: 28,830,905 F237S probably damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Naip2 A T 13: 100,144,588 I1316N probably damaging Het
Naip6 C T 13: 100,300,729 G429S probably benign Het
Noct C T 3: 51,248,044 R78C probably damaging Het
Npbwr1 A G 1: 5,917,175 V40A possibly damaging Het
Nsd2 A G 5: 33,843,402 N88D probably damaging Het
Olfr1020 T A 2: 85,850,400 V316E probably benign Het
Olfr1066 T C 2: 86,455,473 H266R probably benign Het
Olfr389 T A 11: 73,776,713 I205F probably benign Het
Olfr800 T A 10: 129,660,421 I205N probably benign Het
Pak7 T A 2: 136,116,637 H177L probably benign Het
Pard3 C T 8: 127,064,347 probably null Het
Pde4c A G 8: 70,747,358 probably null Het
Pde6h T A 6: 136,963,205 I63N probably damaging Het
Phldb2 T C 16: 45,774,195 K916E possibly damaging Het
Ppig T C 2: 69,741,644 S236P unknown Het
Ptprd T C 4: 75,954,122 Y1370C probably damaging Het
Pzp T C 6: 128,516,120 T352A probably benign Het
Rab3gap1 A G 1: 127,903,719 Y177C possibly damaging Het
Rasgef1a G A 6: 118,089,196 V457M probably benign Het
Scel A T 14: 103,610,790 T616S possibly damaging Het
Sel1l A T 12: 91,826,550 Y228* probably null Het
Sgms1 A G 19: 32,159,683 V161A possibly damaging Het
Slfnl1 T C 4: 120,533,227 L25P probably benign Het
Smad5 A G 13: 56,737,374 T432A probably damaging Het
Sohlh2 T C 3: 55,192,341 probably null Het
Sphkap A T 1: 83,276,662 M835K probably damaging Het
Sqor A C 2: 122,798,098 T174P probably damaging Het
Stkld1 T C 2: 26,952,747 V577A probably damaging Het
Sulf2 T A 2: 166,080,853 E652D probably benign Het
Sycp2 T A 2: 178,378,055 Q556L probably benign Het
Syk A G 13: 52,611,238 T134A probably benign Het
Tas2r122 T A 6: 132,711,622 I103F possibly damaging Het
Tex10 A G 4: 48,451,940 W729R probably damaging Het
Tex261 G T 6: 83,773,731 P95T probably damaging Het
Tm2d2 T C 8: 25,017,507 S47P probably benign Het
Tmem2 A G 19: 21,801,987 D387G probably benign Het
Tmem95 A G 11: 69,876,991 S128P probably damaging Het
Tnxb G A 17: 34,692,579 A1619T possibly damaging Het
Trappc9 A G 15: 73,058,036 I157T probably damaging Het
Unc13c T A 9: 73,483,615 probably null Het
Upb1 A T 10: 75,429,969 Y210F probably damaging Het
Urb1 T C 16: 90,762,344 M1684V probably benign Het
Wnk2 G A 13: 49,078,682 P727S possibly damaging Het
Zfp551 A T 7: 12,416,349 S378T probably damaging Het
Zfp598 T C 17: 24,669,924 V56A possibly damaging Het
Zfp945 C T 17: 22,857,249 probably null Het
Other mutations in Lingo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Lingo4 APN 3 94403288 missense probably benign 0.00
IGL02662:Lingo4 APN 3 94401817 unclassified probably benign
IGL02687:Lingo4 APN 3 94402097 missense probably damaging 1.00
IGL02711:Lingo4 APN 3 94403393 missense probably benign
IGL03001:Lingo4 APN 3 94402396 missense probably damaging 1.00
IGL03260:Lingo4 APN 3 94401943 missense probably benign
PIT4449001:Lingo4 UTSW 3 94401932 missense probably benign
R0088:Lingo4 UTSW 3 94402033 missense probably benign 0.39
R0616:Lingo4 UTSW 3 94403081 missense probably benign 0.00
R1455:Lingo4 UTSW 3 94399392 unclassified probably benign
R1733:Lingo4 UTSW 3 94403178 missense probably benign 0.00
R2085:Lingo4 UTSW 3 94402245 missense probably damaging 1.00
R3793:Lingo4 UTSW 3 94402378 missense probably benign
R3805:Lingo4 UTSW 3 94402100 missense probably damaging 1.00
R3806:Lingo4 UTSW 3 94402100 missense probably damaging 1.00
R4438:Lingo4 UTSW 3 94402897 missense possibly damaging 0.79
R4660:Lingo4 UTSW 3 94403365 missense probably benign 0.00
R4724:Lingo4 UTSW 3 94402876 nonsense probably null
R4981:Lingo4 UTSW 3 94399454 missense probably benign 0.18
R4994:Lingo4 UTSW 3 94402541 missense probably benign
R4994:Lingo4 UTSW 3 94403001 missense probably benign 0.02
R5600:Lingo4 UTSW 3 94401913 missense probably benign
R6188:Lingo4 UTSW 3 94402850 missense probably damaging 1.00
R6267:Lingo4 UTSW 3 94403390 missense probably benign 0.02
R6303:Lingo4 UTSW 3 94403206 missense probably damaging 1.00
R6304:Lingo4 UTSW 3 94403206 missense probably damaging 1.00
R6789:Lingo4 UTSW 3 94399355 unclassified probably benign
R7313:Lingo4 UTSW 3 94403144 missense possibly damaging 0.95
R7329:Lingo4 UTSW 3 94402855 missense probably benign
R7631:Lingo4 UTSW 3 94399460 missense possibly damaging 0.93
R7908:Lingo4 UTSW 3 94402234 missense probably benign 0.19
R8277:Lingo4 UTSW 3 94402624 missense possibly damaging 0.61
X0054:Lingo4 UTSW 3 94403376 missense possibly damaging 0.54
Z1177:Lingo4 UTSW 3 94402994 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-08-25