Mutagenetix > Incidental Mutation

Incidental Mutation 'R2001:Ago1'

225915

Institutional Source

Beutler Lab

Gene Symbol

Ago1

Ensembl Gene

ENSMUSG00000041530

Gene Name

argonaute RISC catalytic subunit 1

Synonyms

Eif2c1, argonaute 1

MMRRC Submission

040011-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.811) question?

Stock #

R2001 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

126435012-126468583 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 126454394 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 44 (I44V)

Ref Sequence

ENSEMBL: ENSMUSP00000134871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]

AlphaFold

Q8CJG1

Predicted Effect

probably null
Transcript: ENSMUST00000097888
AA Change: I351V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: I351V

Domain	Start	End	E-Value	Type
Pfam:ArgoN	26	164	2.3e-26	PFAM
DUF1785	173	225	3.48e-25	SMART
PAZ	233	368	1.41e-5	SMART
Pfam:ArgoL2	373	418	3.6e-18	PFAM
Pfam:ArgoMid	427	509	7.6e-37	PFAM
Piwi	515	816	4.16e-131	SMART
Blast:Piwi	823	849	3e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000127800

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149425

Predicted Effect

probably null
Transcript: ENSMUST00000176315
AA Change: I44V

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530
AA Change: I44V

Domain	Start	End	E-Value	Type
Pfam:PAZ	1	62	4.1e-23	PFAM
Piwi	211	512	4.16e-131	SMART
Blast:Piwi	519	545	2e-6	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,741,456	S559P	probably benign	Het
A430005L14Rik	T	A	4: 153,959,857	C42S	probably damaging	Het
Abca13	A	T	11: 9,273,967	T449S	probably benign	Het
Acvr1c	T	A	2: 58,315,975	Q41L	probably benign	Het
Adamts13	C	T	2: 26,973,990	P60L	probably benign	Het
Adamts20	T	C	15: 94,347,718	T568A	possibly damaging	Het
Agtpbp1	TGAAGATGCATCTTGAGAAGA	TGAAGA	13: 59,475,803		probably null	Het
Ankrd28	A	T	14: 31,745,336	V39E	possibly damaging	Het
Apaf1	A	G	10: 91,061,814	V269A	possibly damaging	Het
Asna1	T	C	8: 85,025,160	S36G	probably damaging	Het
Astn1	A	G	1: 158,520,521	N506D	probably damaging	Het
BC051019	G	A	7: 109,720,551	Q102*	probably null	Het
Bpifb5	A	G	2: 154,233,279	T376A	possibly damaging	Het
Ccdc121	G	T	1: 181,510,986	Q134K	probably benign	Het
Ccl20	ATT	ATTT	1: 83,117,855		probably null	Het
Ccl6	G	T	11: 83,589,337	P68T	possibly damaging	Het
Cd300ld	A	T	11: 114,987,330	F119I	probably benign	Het
Cdk2ap2	A	G	19: 4,097,903	M57V	possibly damaging	Het
Chkb	C	T	15: 89,428,766	G36E	probably damaging	Het
Col11a1	A	G	3: 114,165,293		probably null	Het
Ctla2b	T	C	13: 60,896,067	Y120C	probably damaging	Het
Ctnnd1	T	C	2: 84,620,360	N172S	probably benign	Het
Cyp2a22	G	A	7: 26,934,772	P319L	probably damaging	Het
Dcaf12	A	C	4: 41,302,804	V117G	probably damaging	Het
Ddx6	A	G	9: 44,607,534	T48A	probably benign	Het
Dgki	T	C	6: 36,865,801	D923G	possibly damaging	Het
Dhx37	G	T	5: 125,427,464	T345K	probably damaging	Het
Dhx9	A	T	1: 153,456,111	Y1370*	probably null	Het
Dnah7b	T	C	1: 46,142,087	S1045P	possibly damaging	Het
Dnmbp	G	C	19: 43,850,173	T1071S	possibly damaging	Het
Dspp	T	A	5: 104,178,559	S929R	unknown	Het
Dst	A	T	1: 34,184,063	E1625D	probably damaging	Het
Egflam	T	A	15: 7,242,567	H630L	probably benign	Het
Elane	T	C	10: 79,887,759	V186A	possibly damaging	Het
Fam209	C	A	2: 172,472,769	N59K	probably benign	Het
Gbe1	A	G	16: 70,528,926	E617G	probably damaging	Het
Gfra1	A	G	19: 58,300,275	L246P	probably damaging	Het
Gm14139	T	A	2: 150,192,947	M396K	probably benign	Het
Gria2	T	C	3: 80,710,805	T308A	probably benign	Het
Grip2	A	T	6: 91,779,850	V540D	probably benign	Het
Hhipl1	A	T	12: 108,321,859	I575F	possibly damaging	Het
Hmcn1	T	A	1: 150,738,613	E1347D	possibly damaging	Het
Itga2b	C	A	11: 102,467,339	A187S	probably benign	Het
Kalrn	C	A	16: 34,028,045	R469M	probably damaging	Het
Kif23	A	T	9: 61,927,384	C426*	probably null	Het
Lck	T	C	4: 129,548,937	N475S	probably benign	Het
Leng8	A	G	7: 4,145,074	N642S	probably damaging	Het
Lingo4	T	A	3: 94,403,075	I440N	probably damaging	Het
Lrrc4	A	G	6: 28,830,905	F237S	probably damaging	Het
Magel2	G	A	7: 62,379,096	V583I	unknown	Het
Naip2	A	T	13: 100,144,588	I1316N	probably damaging	Het
Naip6	C	T	13: 100,300,729	G429S	probably benign	Het
Noct	C	T	3: 51,248,044	R78C	probably damaging	Het
Npbwr1	A	G	1: 5,917,175	V40A	possibly damaging	Het
Nsd2	A	G	5: 33,843,402	N88D	probably damaging	Het
Olfr1020	T	A	2: 85,850,400	V316E	probably benign	Het
Olfr1066	T	C	2: 86,455,473	H266R	probably benign	Het
Olfr389	T	A	11: 73,776,713	I205F	probably benign	Het
Olfr800	T	A	10: 129,660,421	I205N	probably benign	Het
Pak7	T	A	2: 136,116,637	H177L	probably benign	Het
Pard3	C	T	8: 127,064,347		probably null	Het
Pde4c	A	G	8: 70,747,358		probably null	Het
Pde6h	T	A	6: 136,963,205	I63N	probably damaging	Het
Phldb2	T	C	16: 45,774,195	K916E	possibly damaging	Het
Ppig	T	C	2: 69,741,644	S236P	unknown	Het
Ptprd	T	C	4: 75,954,122	Y1370C	probably damaging	Het
Pzp	T	C	6: 128,516,120	T352A	probably benign	Het
Rab3gap1	A	G	1: 127,903,719	Y177C	possibly damaging	Het
Rasgef1a	G	A	6: 118,089,196	V457M	probably benign	Het
Scel	A	T	14: 103,610,790	T616S	possibly damaging	Het
Sel1l	A	T	12: 91,826,550	Y228*	probably null	Het
Sgms1	A	G	19: 32,159,683	V161A	possibly damaging	Het
Slfnl1	T	C	4: 120,533,227	L25P	probably benign	Het
Smad5	A	G	13: 56,737,374	T432A	probably damaging	Het
Sohlh2	T	C	3: 55,192,341		probably null	Het
Sphkap	A	T	1: 83,276,662	M835K	probably damaging	Het
Sqor	A	C	2: 122,798,098	T174P	probably damaging	Het
Stkld1	T	C	2: 26,952,747	V577A	probably damaging	Het
Sulf2	T	A	2: 166,080,853	E652D	probably benign	Het
Sycp2	T	A	2: 178,378,055	Q556L	probably benign	Het
Syk	A	G	13: 52,611,238	T134A	probably benign	Het
Tas2r122	T	A	6: 132,711,622	I103F	possibly damaging	Het
Tex10	A	G	4: 48,451,940	W729R	probably damaging	Het
Tex261	G	T	6: 83,773,731	P95T	probably damaging	Het
Tm2d2	T	C	8: 25,017,507	S47P	probably benign	Het
Tmem2	A	G	19: 21,801,987	D387G	probably benign	Het
Tmem95	A	G	11: 69,876,991	S128P	probably damaging	Het
Tnxb	G	A	17: 34,692,579	A1619T	possibly damaging	Het
Trappc9	A	G	15: 73,058,036	I157T	probably damaging	Het
Unc13c	T	A	9: 73,483,615		probably null	Het
Upb1	A	T	10: 75,429,969	Y210F	probably damaging	Het
Urb1	T	C	16: 90,762,344	M1684V	probably benign	Het
Wnk2	G	A	13: 49,078,682	P727S	possibly damaging	Het
Zfp551	A	T	7: 12,416,349	S378T	probably damaging	Het
Zfp598	T	C	17: 24,669,924	V56A	possibly damaging	Het
Zfp945	C	T	17: 22,857,249		probably null	Het

Other mutations in Ago1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01377:Ago1	APN	4	126459817	missense	probably damaging	0.98
IGL02578:Ago1	APN	4	126439531	missense	probably benign	0.12
IGL02709:Ago1	APN	4	126453640	nonsense	probably null
IGL02810:Ago1	APN	4	126443093	missense	probably benign	0.00
IGL03037:Ago1	APN	4	126461794	missense	probably benign	0.00
IGL03091:Ago1	APN	4	126459189	missense	probably damaging	0.98
IGL03100:Ago1	APN	4	126443171	missense	probably benign	0.08
IGL03121:Ago1	APN	4	126460003	missense	probably benign	0.00
R0195:Ago1	UTSW	4	126463691	missense	probably benign	0.01
R0244:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R0309:Ago1	UTSW	4	126443166	missense	probably benign	0.06
R0514:Ago1	UTSW	4	126439595	missense	probably benign
R0557:Ago1	UTSW	4	126460024	missense	probably benign	0.00
R1104:Ago1	UTSW	4	126453633	missense	probably damaging	0.99
R1553:Ago1	UTSW	4	126440401	missense	probably damaging	0.99
R1624:Ago1	UTSW	4	126463741	missense	probably damaging	0.97
R1851:Ago1	UTSW	4	126439995	missense	probably benign	0.00
R1867:Ago1	UTSW	4	126441236	missense	probably damaging	0.98
R2051:Ago1	UTSW	4	126460453	missense	probably benign	0.01
R2057:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R2105:Ago1	UTSW	4	126461788	missense	probably benign	0.30
R2117:Ago1	UTSW	4	126463857	splice site	probably null
R2256:Ago1	UTSW	4	126441911	missense	possibly damaging	0.80
R2272:Ago1	UTSW	4	126453650	missense	probably benign	0.01
R2517:Ago1	UTSW	4	126439939	nonsense	probably null
R2850:Ago1	UTSW	4	126443075	splice site	probably benign
R2993:Ago1	UTSW	4	126440046	splice site	probably benign
R3746:Ago1	UTSW	4	126461044	missense	probably benign
R3747:Ago1	UTSW	4	126461044	missense	probably benign
R3750:Ago1	UTSW	4	126461044	missense	probably benign
R4600:Ago1	UTSW	4	126460392	missense	probably benign	0.37
R4934:Ago1	UTSW	4	126448859	missense	possibly damaging	0.56
R4983:Ago1	UTSW	4	126453654	missense	probably damaging	0.99
R5086:Ago1	UTSW	4	126453604	missense	probably benign	0.01
R5132:Ago1	UTSW	4	126461723	missense	probably benign	0.01
R5239:Ago1	UTSW	4	126441215	missense	probably damaging	1.00
R5609:Ago1	UTSW	4	126461037	missense	possibly damaging	0.80
R5705:Ago1	UTSW	4	126448794	missense	probably benign	0.01
R5980:Ago1	UTSW	4	126460569	unclassified	probably benign
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6398:Ago1	UTSW	4	126448808	missense	probably benign	0.26
R6505:Ago1	UTSW	4	126463835	missense	probably benign	0.00
R6545:Ago1	UTSW	4	126454352	missense	possibly damaging	0.74
R6944:Ago1	UTSW	4	126460422	missense	possibly damaging	0.78
R7041:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R7490:Ago1	UTSW	4	126439505	makesense	probably null
R7496:Ago1	UTSW	4	126461752	missense	probably benign	0.20
R7575:Ago1	UTSW	4	126453908	missense	probably benign	0.12
R7625:Ago1	UTSW	4	126443229	missense	probably benign	0.18
R7988:Ago1	UTSW	4	126460417	missense	probably damaging	1.00
R8041:Ago1	UTSW	4	126441936	missense	probably damaging	1.00
R8073:Ago1	UTSW	4	126443226	missense	probably benign	0.04
R8086:Ago1	UTSW	4	126460981	missense	probably benign
R8127:Ago1	UTSW	4	126454421	missense	possibly damaging	0.95
R8772:Ago1	UTSW	4	126460523	unclassified	probably benign
R8878:Ago1	UTSW	4	126463723	missense	probably benign	0.35
R8989:Ago1	UTSW	4	126463790	missense	probably benign	0.01
R9140:Ago1	UTSW	4	126443184	missense	probably benign
X0025:Ago1	UTSW	4	126443115	missense	possibly damaging	0.47
Z1177:Ago1	UTSW	4	126453656	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCAGACAATAAAACTAGACTTGGG -3'
(R):5'- CTGATCATAGATCCACCCTGG -3'

Sequencing Primer
(F):5'- GTCTTACTAGACTGACCATTAAAGC -3'
(R):5'- CACCCTGGATTCCAAACTTTTG -3'

Posted On

2014-08-25