Mutagenetix > Incidental Mutations

Incidental Mutation 'R2001:Lck'

225916

Institutional Source

Beutler Lab

Gene Symbol

Lck

Ensembl Gene

ENSMUSG00000000409

Gene Name

lymphocyte protein tyrosine kinase

Synonyms

Hck-3, p56

MMRRC Submission

040011-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2001 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

129548344-129573641 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 129548937 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 475 (N475S)

Ref Sequence

ENSEMBL: ENSMUSP00000125777 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067240] [ENSMUST00000102596] [ENSMUST00000167288]

Predicted Effect

probably benign
Transcript: ENSMUST00000067240
AA Change: N464S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000066209
Gene: ENSMUSG00000000409
AA Change: N464S

Domain	Start	End	E-Value	Type
SH3	64	120	3.53e-17	SMART
SH2	125	215	2.07e-34	SMART
TyrKc	245	494	2.66e-133	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102596
AA Change: N464S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000099656
Gene: ENSMUSG00000000409
AA Change: N464S

Domain	Start	End	E-Value	Type
SH3	64	120	3.53e-17	SMART
SH2	125	215	2.07e-34	SMART
TyrKc	245	494	2.66e-133	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127943

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132030

Predicted Effect

probably benign
Transcript: ENSMUST00000167288
AA Change: N475S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000125777
Gene: ENSMUSG00000000409
AA Change: N475S

Domain	Start	End	E-Value	Type
SH3	75	131	3.53e-17	SMART
SH2	136	226	2.07e-34	SMART
TyrKc	256	505	2.66e-133	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit thymic atrophy with reduced numbers of peripheral T cells. Null mutants have few double positive and no mature single positive (SP) thymocytes. A hypomorph has decreased expression of CD3epsilon chain onSP thymocytes, whose numbers are reduced. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,741,456	S559P	probably benign	Het
A430005L14Rik	T	A	4: 153,959,857	C42S	probably damaging	Het
Abca13	A	T	11: 9,273,967	T449S	probably benign	Het
Acvr1c	T	A	2: 58,315,975	Q41L	probably benign	Het
Adamts13	C	T	2: 26,973,990	P60L	probably benign	Het
Adamts20	T	C	15: 94,347,718	T568A	possibly damaging	Het
Ago1	T	C	4: 126,454,394	I44V	probably null	Het
Agtpbp1	TGAAGATGCATCTTGAGAAGA	TGAAGA	13: 59,475,803		probably null	Het
Ankrd28	A	T	14: 31,745,336	V39E	possibly damaging	Het
Apaf1	A	G	10: 91,061,814	V269A	possibly damaging	Het
Asna1	T	C	8: 85,025,160	S36G	probably damaging	Het
Astn1	A	G	1: 158,520,521	N506D	probably damaging	Het
BC051019	G	A	7: 109,720,551	Q102*	probably null	Het
Bpifb5	A	G	2: 154,233,279	T376A	possibly damaging	Het
Ccdc121	G	T	1: 181,510,986	Q134K	probably benign	Het
Ccl20	ATT	ATTT	1: 83,117,855		probably null	Het
Ccl6	G	T	11: 83,589,337	P68T	possibly damaging	Het
Cd300ld	A	T	11: 114,987,330	F119I	probably benign	Het
Cdk2ap2	A	G	19: 4,097,903	M57V	possibly damaging	Het
Chkb	C	T	15: 89,428,766	G36E	probably damaging	Het
Col11a1	A	G	3: 114,165,293		probably null	Het
Ctla2b	T	C	13: 60,896,067	Y120C	probably damaging	Het
Ctnnd1	T	C	2: 84,620,360	N172S	probably benign	Het
Cyp2a22	G	A	7: 26,934,772	P319L	probably damaging	Het
Dcaf12	A	C	4: 41,302,804	V117G	probably damaging	Het
Ddx6	A	G	9: 44,607,534	T48A	probably benign	Het
Dgki	T	C	6: 36,865,801	D923G	possibly damaging	Het
Dhx37	G	T	5: 125,427,464	T345K	probably damaging	Het
Dhx9	A	T	1: 153,456,111	Y1370*	probably null	Het
Dnah7b	T	C	1: 46,142,087	S1045P	possibly damaging	Het
Dnmbp	G	C	19: 43,850,173	T1071S	possibly damaging	Het
Dspp	T	A	5: 104,178,559	S929R	unknown	Het
Dst	A	T	1: 34,184,063	E1625D	probably damaging	Het
Egflam	T	A	15: 7,242,567	H630L	probably benign	Het
Elane	T	C	10: 79,887,759	V186A	possibly damaging	Het
Fam209	C	A	2: 172,472,769	N59K	probably benign	Het
Gbe1	A	G	16: 70,528,926	E617G	probably damaging	Het
Gfra1	A	G	19: 58,300,275	L246P	probably damaging	Het
Gm14139	T	A	2: 150,192,947	M396K	probably benign	Het
Gria2	T	C	3: 80,710,805	T308A	probably benign	Het
Grip2	A	T	6: 91,779,850	V540D	probably benign	Het
Hhipl1	A	T	12: 108,321,859	I575F	possibly damaging	Het
Hmcn1	T	A	1: 150,738,613	E1347D	possibly damaging	Het
Itga2b	C	A	11: 102,467,339	A187S	probably benign	Het
Kalrn	C	A	16: 34,028,045	R469M	probably damaging	Het
Kif23	A	T	9: 61,927,384	C426*	probably null	Het
Leng8	A	G	7: 4,145,074	N642S	probably damaging	Het
Lingo4	T	A	3: 94,403,075	I440N	probably damaging	Het
Lrrc4	A	G	6: 28,830,905	F237S	probably damaging	Het
Magel2	G	A	7: 62,379,096	V583I	unknown	Het
Naip2	A	T	13: 100,144,588	I1316N	probably damaging	Het
Naip6	C	T	13: 100,300,729	G429S	probably benign	Het
Noct	C	T	3: 51,248,044	R78C	probably damaging	Het
Npbwr1	A	G	1: 5,917,175	V40A	possibly damaging	Het
Nsd2	A	G	5: 33,843,402	N88D	probably damaging	Het
Olfr1020	T	A	2: 85,850,400	V316E	probably benign	Het
Olfr1066	T	C	2: 86,455,473	H266R	probably benign	Het
Olfr389	T	A	11: 73,776,713	I205F	probably benign	Het
Olfr800	T	A	10: 129,660,421	I205N	probably benign	Het
Pak7	T	A	2: 136,116,637	H177L	probably benign	Het
Pard3	C	T	8: 127,064,347		probably null	Het
Pde4c	A	G	8: 70,747,358		probably null	Het
Pde6h	T	A	6: 136,963,205	I63N	probably damaging	Het
Phldb2	T	C	16: 45,774,195	K916E	possibly damaging	Het
Ppig	T	C	2: 69,741,644	S236P	unknown	Het
Ptprd	T	C	4: 75,954,122	Y1370C	probably damaging	Het
Pzp	T	C	6: 128,516,120	T352A	probably benign	Het
Rab3gap1	A	G	1: 127,903,719	Y177C	possibly damaging	Het
Rasgef1a	G	A	6: 118,089,196	V457M	probably benign	Het
Scel	A	T	14: 103,610,790	T616S	possibly damaging	Het
Sel1l	A	T	12: 91,826,550	Y228*	probably null	Het
Sgms1	A	G	19: 32,159,683	V161A	possibly damaging	Het
Slfnl1	T	C	4: 120,533,227	L25P	probably benign	Het
Smad5	A	G	13: 56,737,374	T432A	probably damaging	Het
Sohlh2	T	C	3: 55,192,341		probably null	Het
Sphkap	A	T	1: 83,276,662	M835K	probably damaging	Het
Sqor	A	C	2: 122,798,098	T174P	probably damaging	Het
Stkld1	T	C	2: 26,952,747	V577A	probably damaging	Het
Sulf2	T	A	2: 166,080,853	E652D	probably benign	Het
Sycp2	T	A	2: 178,378,055	Q556L	probably benign	Het
Syk	A	G	13: 52,611,238	T134A	probably benign	Het
Tas2r122	T	A	6: 132,711,622	I103F	possibly damaging	Het
Tex10	A	G	4: 48,451,940	W729R	probably damaging	Het
Tex261	G	T	6: 83,773,731	P95T	probably damaging	Het
Tm2d2	T	C	8: 25,017,507	S47P	probably benign	Het
Tmem2	A	G	19: 21,801,987	D387G	probably benign	Het
Tmem95	A	G	11: 69,876,991	S128P	probably damaging	Het
Tnxb	G	A	17: 34,692,579	A1619T	possibly damaging	Het
Trappc9	A	G	15: 73,058,036	I157T	probably damaging	Het
Unc13c	T	A	9: 73,483,615		probably null	Het
Upb1	A	T	10: 75,429,969	Y210F	probably damaging	Het
Urb1	T	C	16: 90,762,344	M1684V	probably benign	Het
Wnk2	G	A	13: 49,078,682	P727S	possibly damaging	Het
Zfp551	A	T	7: 12,416,349	S378T	probably damaging	Het
Zfp598	T	C	17: 24,669,924	V56A	possibly damaging	Het
Zfp945	C	T	17: 22,857,249		probably null	Het

Other mutations in Lck

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01824:Lck	APN	4	129558146	missense	probably benign	0.00
IGL02666:Lck	APN	4	129556419	missense	probably damaging	0.98
iconoclast	UTSW	4	129555604	missense	probably damaging	1.00
lockdown	UTSW	4	129558127	missense	probably damaging	1.00
stromberg	UTSW	4	129555640	missense	probably damaging	1.00
swan	UTSW	4	129555640	missense	probably damaging	1.00
R0091:Lck	UTSW	4	129555681	missense	possibly damaging	0.88
R0480:Lck	UTSW	4	129555640	missense	probably damaging	1.00
R1013:Lck	UTSW	4	129558127	missense	probably damaging	1.00
R1510:Lck	UTSW	4	129555668	missense	possibly damaging	0.92
R1569:Lck	UTSW	4	129555656	missense	probably damaging	0.98
R1845:Lck	UTSW	4	129558086	missense	probably benign	0.00
R2141:Lck	UTSW	4	129548920	missense	probably damaging	1.00
R4694:Lck	UTSW	4	129548972	missense	possibly damaging	0.66
R4737:Lck	UTSW	4	129555984	missense	possibly damaging	0.93
R5706:Lck	UTSW	4	129551638	critical splice acceptor site	probably null
R5712:Lck	UTSW	4	129556310	missense	probably benign
R7023:Lck	UTSW	4	129548865	missense	possibly damaging	0.89
R7411:Lck	UTSW	4	129551970	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GTTGGGAGGATCTTGGGACC -3'
(R):5'- TGGATGGATGGATGGATAGATACAT -3'

Sequencing Primer
(F):5'- GAGGATCTTGGGACCGAAAG -3'
(R):5'- CAGCCTTGCTTTTGAGT -3'

Posted On

2014-08-25