Mutagenetix > Incidental Mutations

Incidental Mutation 'R2001:Nsd2'

225918

Institutional Source

Beutler Lab

Gene Symbol

Nsd2

Ensembl Gene

ENSMUSG00000057406

Gene Name

nuclear receptor binding SET domain protein 2

Synonyms

5830445G22Rik, Whsc1, Whsc1l, C130020C13Rik, 9430010A17Rik, D030027O06Rik, D930023B08Rik

MMRRC Submission

040011-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.854) question?

Stock #

R2001 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33820725-33897975 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33843402 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 88 (N88D)

Ref Sequence

ENSEMBL: ENSMUSP00000123460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058096] [ENSMUST00000066854] [ENSMUST00000075812] [ENSMUST00000114397] [ENSMUST00000114399] [ENSMUST00000137191] [ENSMUST00000139845] [ENSMUST00000155880]

Predicted Effect

probably damaging
Transcript: ENSMUST00000058096
AA Change: N88D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000058940
Gene: ENSMUSG00000057406
AA Change: N88D

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
PWWP	220	285	3.84e-15	SMART
low complexity region	397	408	N/A	INTRINSIC
HMG	452	522	7.64e-9	SMART
low complexity region	532	545	N/A	INTRINSIC
low complexity region	629	643	N/A	INTRINSIC
PHD	669	711	1.36e-6	SMART
RING	670	710	1.5e1	SMART
PHD	716	763	6.81e-1	SMART
RING	717	762	5.25e-2	SMART
PHD	833	873	2.35e-10	SMART
PWWP	878	940	2.67e-23	SMART
AWS	1011	1062	3.74e-27	SMART
SET	1063	1186	4.48e-43	SMART
PostSET	1187	1203	7.56e-4	SMART
low complexity region	1215	1236	N/A	INTRINSIC
PHD	1241	1284	1.98e-8	SMART
low complexity region	1347	1360	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000066854
AA Change: N88D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000067205
Gene: ENSMUSG00000057406
AA Change: N88D

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
PWWP	220	285	3.84e-15	SMART
low complexity region	397	408	N/A	INTRINSIC
HMG	452	522	7.64e-9	SMART
low complexity region	532	545	N/A	INTRINSIC
low complexity region	630	644	N/A	INTRINSIC
PHD	670	712	1.36e-6	SMART
RING	671	711	1.5e1	SMART
PHD	717	764	6.81e-1	SMART
RING	718	763	5.25e-2	SMART
PHD	834	874	2.35e-10	SMART
PWWP	879	941	2.67e-23	SMART
AWS	1012	1063	3.74e-27	SMART
SET	1064	1187	4.48e-43	SMART
PostSET	1188	1204	7.56e-4	SMART
low complexity region	1216	1237	N/A	INTRINSIC
PHD	1242	1285	1.98e-8	SMART
low complexity region	1348	1361	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000075812
AA Change: N88D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000075210
Gene: ENSMUSG00000057406
AA Change: N88D

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
PWWP	220	285	3.84e-15	SMART
low complexity region	397	408	N/A	INTRINSIC
HMG	452	522	7.64e-9	SMART
low complexity region	532	545	N/A	INTRINSIC
low complexity region	630	644	N/A	INTRINSIC
PHD	670	712	1.36e-6	SMART
RING	671	711	1.5e1	SMART
PHD	717	764	6.81e-1	SMART
RING	718	763	5.25e-2	SMART
PHD	834	874	2.35e-10	SMART
PWWP	879	941	2.67e-23	SMART
AWS	1012	1063	3.74e-27	SMART
SET	1064	1187	4.48e-43	SMART
PostSET	1188	1204	7.56e-4	SMART
low complexity region	1216	1237	N/A	INTRINSIC
PHD	1242	1285	1.98e-8	SMART
low complexity region	1348	1361	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114397
AA Change: N88D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110039
Gene: ENSMUSG00000057406
AA Change: N88D

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
Pfam:PWWP	220	332	4.7e-26	PFAM
low complexity region	397	408	N/A	INTRINSIC
HMG	452	522	7.64e-9	SMART
low complexity region	532	545	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114399
AA Change: N88D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110041
Gene: ENSMUSG00000057406
AA Change: N88D

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
Pfam:PWWP	220	332	4.9e-26	PFAM
low complexity region	397	408	N/A	INTRINSIC
HMG	452	522	7.64e-9	SMART
low complexity region	532	545	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000137191
AA Change: N88D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122310
Gene: ENSMUSG00000057406
AA Change: N88D

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
Pfam:PWWP	220	332	4.9e-26	PFAM
low complexity region	397	408	N/A	INTRINSIC
HMG	452	522	7.64e-9	SMART
low complexity region	532	545	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000139845
AA Change: N88D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000123460
Gene: ENSMUSG00000057406
AA Change: N88D

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
Pfam:PWWP	220	332	4.9e-26	PFAM
low complexity region	397	408	N/A	INTRINSIC
HMG	452	522	7.64e-9	SMART
low complexity region	532	545	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000141416
AA Change: N69D

SMART Domains

Protein: ENSMUSP00000117233
Gene: ENSMUSG00000057406
AA Change: N69D

Domain	Start	End	E-Value	Type
Pfam:PWWP	202	314	1.1e-25	PFAM
low complexity region	379	390	N/A	INTRINSIC
HMG	434	504	4.7e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000155880
AA Change: N88D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000121805
Gene: ENSMUSG00000057406
AA Change: N88D

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains four domains present in other developmental proteins: a PWWP domain, an HMG box, a SET domain, and a PHD-type zinc finger. It is expressed ubiquitously in early development. Wolf-Hirschhorn syndrome (WHS) is a malformation syndrome associated with a hemizygous deletion of the distal short arm of chromosome 4. This gene maps to the 165 kb WHS critical region and has also been involved in the chromosomal translocation t(4;14)(p16.3;q32.3) in multiple myelomas. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Some transcript variants are nonsense-mediated mRNA (NMD) decay candidates, hence not represented as reference sequences. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced fetal size, failed sternum ossification, cleft palate, atrial and ventricular septal defects, stunted growth and postnatal death. Some heterozygotes show severe growth defects, malocclusion, delayed sternum ossification and hypoplasia of the septum secundum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,741,456	S559P	probably benign	Het
A430005L14Rik	T	A	4: 153,959,857	C42S	probably damaging	Het
Abca13	A	T	11: 9,273,967	T449S	probably benign	Het
Acvr1c	T	A	2: 58,315,975	Q41L	probably benign	Het
Adamts13	C	T	2: 26,973,990	P60L	probably benign	Het
Adamts20	T	C	15: 94,347,718	T568A	possibly damaging	Het
Ago1	T	C	4: 126,454,394	I44V	probably null	Het
Agtpbp1	TGAAGATGCATCTTGAGAAGA	TGAAGA	13: 59,475,803		probably null	Het
Ankrd28	A	T	14: 31,745,336	V39E	possibly damaging	Het
Apaf1	A	G	10: 91,061,814	V269A	possibly damaging	Het
Asna1	T	C	8: 85,025,160	S36G	probably damaging	Het
Astn1	A	G	1: 158,520,521	N506D	probably damaging	Het
BC051019	G	A	7: 109,720,551	Q102*	probably null	Het
Bpifb5	A	G	2: 154,233,279	T376A	possibly damaging	Het
Ccdc121	G	T	1: 181,510,986	Q134K	probably benign	Het
Ccl20	ATT	ATTT	1: 83,117,855		probably null	Het
Ccl6	G	T	11: 83,589,337	P68T	possibly damaging	Het
Cd300ld	A	T	11: 114,987,330	F119I	probably benign	Het
Cdk2ap2	A	G	19: 4,097,903	M57V	possibly damaging	Het
Chkb	C	T	15: 89,428,766	G36E	probably damaging	Het
Col11a1	A	G	3: 114,165,293		probably null	Het
Ctla2b	T	C	13: 60,896,067	Y120C	probably damaging	Het
Ctnnd1	T	C	2: 84,620,360	N172S	probably benign	Het
Cyp2a22	G	A	7: 26,934,772	P319L	probably damaging	Het
Dcaf12	A	C	4: 41,302,804	V117G	probably damaging	Het
Ddx6	A	G	9: 44,607,534	T48A	probably benign	Het
Dgki	T	C	6: 36,865,801	D923G	possibly damaging	Het
Dhx37	G	T	5: 125,427,464	T345K	probably damaging	Het
Dhx9	A	T	1: 153,456,111	Y1370*	probably null	Het
Dnah7b	T	C	1: 46,142,087	S1045P	possibly damaging	Het
Dnmbp	G	C	19: 43,850,173	T1071S	possibly damaging	Het
Dspp	T	A	5: 104,178,559	S929R	unknown	Het
Dst	A	T	1: 34,184,063	E1625D	probably damaging	Het
Egflam	T	A	15: 7,242,567	H630L	probably benign	Het
Elane	T	C	10: 79,887,759	V186A	possibly damaging	Het
Fam209	C	A	2: 172,472,769	N59K	probably benign	Het
Gbe1	A	G	16: 70,528,926	E617G	probably damaging	Het
Gfra1	A	G	19: 58,300,275	L246P	probably damaging	Het
Gm14139	T	A	2: 150,192,947	M396K	probably benign	Het
Gria2	T	C	3: 80,710,805	T308A	probably benign	Het
Grip2	A	T	6: 91,779,850	V540D	probably benign	Het
Hhipl1	A	T	12: 108,321,859	I575F	possibly damaging	Het
Hmcn1	T	A	1: 150,738,613	E1347D	possibly damaging	Het
Itga2b	C	A	11: 102,467,339	A187S	probably benign	Het
Kalrn	C	A	16: 34,028,045	R469M	probably damaging	Het
Kif23	A	T	9: 61,927,384	C426*	probably null	Het
Lck	T	C	4: 129,548,937	N475S	probably benign	Het
Leng8	A	G	7: 4,145,074	N642S	probably damaging	Het
Lingo4	T	A	3: 94,403,075	I440N	probably damaging	Het
Lrrc4	A	G	6: 28,830,905	F237S	probably damaging	Het
Magel2	G	A	7: 62,379,096	V583I	unknown	Het
Naip2	A	T	13: 100,144,588	I1316N	probably damaging	Het
Naip6	C	T	13: 100,300,729	G429S	probably benign	Het
Noct	C	T	3: 51,248,044	R78C	probably damaging	Het
Npbwr1	A	G	1: 5,917,175	V40A	possibly damaging	Het
Olfr1020	T	A	2: 85,850,400	V316E	probably benign	Het
Olfr1066	T	C	2: 86,455,473	H266R	probably benign	Het
Olfr389	T	A	11: 73,776,713	I205F	probably benign	Het
Olfr800	T	A	10: 129,660,421	I205N	probably benign	Het
Pak7	T	A	2: 136,116,637	H177L	probably benign	Het
Pard3	C	T	8: 127,064,347		probably null	Het
Pde4c	A	G	8: 70,747,358		probably null	Het
Pde6h	T	A	6: 136,963,205	I63N	probably damaging	Het
Phldb2	T	C	16: 45,774,195	K916E	possibly damaging	Het
Ppig	T	C	2: 69,741,644	S236P	unknown	Het
Ptprd	T	C	4: 75,954,122	Y1370C	probably damaging	Het
Pzp	T	C	6: 128,516,120	T352A	probably benign	Het
Rab3gap1	A	G	1: 127,903,719	Y177C	possibly damaging	Het
Rasgef1a	G	A	6: 118,089,196	V457M	probably benign	Het
Scel	A	T	14: 103,610,790	T616S	possibly damaging	Het
Sel1l	A	T	12: 91,826,550	Y228*	probably null	Het
Sgms1	A	G	19: 32,159,683	V161A	possibly damaging	Het
Slfnl1	T	C	4: 120,533,227	L25P	probably benign	Het
Smad5	A	G	13: 56,737,374	T432A	probably damaging	Het
Sohlh2	T	C	3: 55,192,341		probably null	Het
Sphkap	A	T	1: 83,276,662	M835K	probably damaging	Het
Sqor	A	C	2: 122,798,098	T174P	probably damaging	Het
Stkld1	T	C	2: 26,952,747	V577A	probably damaging	Het
Sulf2	T	A	2: 166,080,853	E652D	probably benign	Het
Sycp2	T	A	2: 178,378,055	Q556L	probably benign	Het
Syk	A	G	13: 52,611,238	T134A	probably benign	Het
Tas2r122	T	A	6: 132,711,622	I103F	possibly damaging	Het
Tex10	A	G	4: 48,451,940	W729R	probably damaging	Het
Tex261	G	T	6: 83,773,731	P95T	probably damaging	Het
Tm2d2	T	C	8: 25,017,507	S47P	probably benign	Het
Tmem2	A	G	19: 21,801,987	D387G	probably benign	Het
Tmem95	A	G	11: 69,876,991	S128P	probably damaging	Het
Tnxb	G	A	17: 34,692,579	A1619T	possibly damaging	Het
Trappc9	A	G	15: 73,058,036	I157T	probably damaging	Het
Unc13c	T	A	9: 73,483,615		probably null	Het
Upb1	A	T	10: 75,429,969	Y210F	probably damaging	Het
Urb1	T	C	16: 90,762,344	M1684V	probably benign	Het
Wnk2	G	A	13: 49,078,682	P727S	possibly damaging	Het
Zfp551	A	T	7: 12,416,349	S378T	probably damaging	Het
Zfp598	T	C	17: 24,669,924	V56A	possibly damaging	Het
Zfp945	C	T	17: 22,857,249		probably null	Het

Other mutations in Nsd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Nsd2	APN	5	33855733	missense	probably damaging	1.00
IGL00420:Nsd2	APN	5	33883003	missense	possibly damaging	0.82
IGL01343:Nsd2	APN	5	33843578	missense	probably damaging	1.00
IGL01403:Nsd2	APN	5	33885378	splice site	probably benign
IGL01446:Nsd2	APN	5	33861186	splice site	probably benign
IGL01571:Nsd2	APN	5	33864687	missense	probably benign	0.32
IGL01862:Nsd2	APN	5	33843736	missense	probably null	1.00
IGL02040:Nsd2	APN	5	33867571	splice site	probably benign
IGL02528:Nsd2	APN	5	33879051	unclassified	probably benign
IGL02553:Nsd2	APN	5	33846198	missense	probably damaging	1.00
IGL02799:Nsd2	APN	5	33864788	splice site	probably benign
IGL02932:Nsd2	APN	5	33880128	missense	probably damaging	1.00
Navratilova	UTSW	5	33885490	missense	probably damaging	0.97
Tennis	UTSW	5	33843513	missense	probably damaging	1.00
R0136:Nsd2	UTSW	5	33855536	missense	possibly damaging	0.89
R0372:Nsd2	UTSW	5	33891551	missense	probably damaging	0.98
R0521:Nsd2	UTSW	5	33843338	missense	probably damaging	1.00
R0548:Nsd2	UTSW	5	33893538	missense	probably damaging	1.00
R0726:Nsd2	UTSW	5	33861028	unclassified	probably benign
R1018:Nsd2	UTSW	5	33843241	missense	probably damaging	1.00
R1638:Nsd2	UTSW	5	33882120	missense	possibly damaging	0.87
R1649:Nsd2	UTSW	5	33854640	missense	probably damaging	0.98
R1675:Nsd2	UTSW	5	33861149	missense	probably benign	0.04
R1900:Nsd2	UTSW	5	33846169	missense	probably benign
R2167:Nsd2	UTSW	5	33882919	missense	probably damaging	1.00
R2261:Nsd2	UTSW	5	33885527	missense	probably damaging	1.00
R2966:Nsd2	UTSW	5	33846122	missense	probably benign	0.01
R3931:Nsd2	UTSW	5	33846117	missense	probably benign	0.01
R4429:Nsd2	UTSW	5	33843202	missense	probably damaging	1.00
R4596:Nsd2	UTSW	5	33882918	missense	probably damaging	1.00
R4958:Nsd2	UTSW	5	33892022	missense	probably damaging	1.00
R5346:Nsd2	UTSW	5	33879136	missense	possibly damaging	0.94
R5957:Nsd2	UTSW	5	33855603	missense	probably damaging	1.00
R6054:Nsd2	UTSW	5	33882161	missense	probably damaging	1.00
R6124:Nsd2	UTSW	5	33843266	missense	probably benign	0.08
R6302:Nsd2	UTSW	5	33867577	missense	possibly damaging	0.93
R6390:Nsd2	UTSW	5	33881181	missense	probably damaging	1.00
R6496:Nsd2	UTSW	5	33843513	missense	probably damaging	1.00
R6828:Nsd2	UTSW	5	33893568	missense	probably damaging	0.98
R6925:Nsd2	UTSW	5	33879110	missense	probably damaging	1.00
R7148:Nsd2	UTSW	5	33885511	missense	possibly damaging	0.57
R7311:Nsd2	UTSW	5	33892036	missense	probably damaging	1.00
R7337:Nsd2	UTSW	5	33885472	missense	probably damaging	1.00
R7466:Nsd2	UTSW	5	33882147	nonsense	probably null
R7567:Nsd2	UTSW	5	33846226	missense	probably damaging	0.99
R7704:Nsd2	UTSW	5	33871467	makesense	probably null
R7822:Nsd2	UTSW	5	33843594	missense	probably damaging	0.97
R7939:Nsd2	UTSW	5	33855589	missense	probably benign	0.22
R8127:Nsd2	UTSW	5	33885490	missense	probably damaging	0.97
R8485:Nsd2	UTSW	5	33882845	missense	probably damaging	1.00
X0020:Nsd2	UTSW	5	33854757	missense	probably damaging	1.00
Z1088:Nsd2	UTSW	5	33855738	critical splice donor site	probably null
Z1177:Nsd2	UTSW	5	33855520	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCAGACACCAGAAATCCTTGG -3'
(R):5'- TCTGACTGAGACACATCAGCAG -3'

Sequencing Primer
(F):5'- CCAGAAATCCTTGGCAGTGC -3'
(R):5'- TGAGACACATCAGCAGCACCG -3'

Posted On

2014-08-25