Incidental Mutation 'R0735:Gm15448'
ID225995
Institutional Source Beutler Lab
Gene Symbol Gm15448
Ensembl Gene ENSMUSG00000074419
Gene Namepredicted gene 15448
SynonymsENSMUSG00000074419
MMRRC Submission 038916-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0735 (G1)
Quality Score58
Status Validated
Chromosome7
Chromosomal Location3816781-3825687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3821782 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 533 (T533A)
Ref Sequence ENSEMBL: ENSMUSP00000140974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094911] [ENSMUST00000108619] [ENSMUST00000108620] [ENSMUST00000153846] [ENSMUST00000189095]
Predicted Effect probably benign
Transcript: ENSMUST00000094911
AA Change: T434A

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000092515
Gene: ENSMUSG00000074419
AA Change: T434A

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG 430 519 8.01e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000108619
AA Change: T535A
SMART Domains Protein: ENSMUSP00000104259
Gene: ENSMUSG00000074419
AA Change: T535A

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG_like 429 517 6.02e0 SMART
IG 529 618 8.01e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108620
AA Change: T434A

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000104260
Gene: ENSMUSG00000074419
AA Change: T434A

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG 430 519 8.01e-3 SMART
low complexity region 538 547 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000153846
AA Change: T535A
SMART Domains Protein: ENSMUSP00000121707
Gene: ENSMUSG00000074419
AA Change: T535A

DomainStartEndE-ValueType
IG 7 96 8.01e-3 SMART
low complexity region 132 141 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189095
AA Change: T533A

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140974
Gene: ENSMUSG00000074419
AA Change: T533A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG_like 40 105 1.3e-2 SMART
IG 129 315 5.7e-4 SMART
IG_like 237 302 9e-4 SMART
IG 328 415 2.6e-3 SMART
IG_like 429 517 2.4e-2 SMART
IG 529 618 3.3e-5 SMART
Meta Mutation Damage Score 0.1629 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 91.8%
Validation Efficiency 95% (73/77)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,717,638 I1552K possibly damaging Het
Actr8 T A 14: 29,989,712 M405K probably benign Het
Adam10 G A 9: 70,748,251 V334I possibly damaging Het
Adgra2 G T 8: 27,117,318 G686C probably damaging Het
Akap11 A T 14: 78,510,078 I1623N probably damaging Het
Astn1 A T 1: 158,472,389 T100S possibly damaging Het
B3galt1 A C 2: 68,118,579 I213L possibly damaging Het
B4galnt4 A G 7: 141,064,323 K101E probably benign Het
Camsap2 A G 1: 136,292,888 S324P probably damaging Het
Chrnb4 A G 9: 55,043,800 S60P probably damaging Het
Cpne1 A G 2: 156,078,750 probably null Het
Cubn G A 2: 13,491,689 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cxcl15 T C 5: 90,801,294 M106T probably benign Het
Cyp2c23 A T 19: 44,016,810 M140K probably damaging Het
Dgke A G 11: 89,060,075 F104S probably benign Het
Dhx36 T A 3: 62,472,729 M849L probably benign Het
Dnah7a C T 1: 53,544,511 E1522K possibly damaging Het
Edil3 G T 13: 89,177,178 V219F probably damaging Het
Egln1 A G 8: 124,948,495 V187A possibly damaging Het
Fam193a T C 5: 34,439,378 I455T possibly damaging Het
Fdft1 A T 14: 63,163,420 I88N probably damaging Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Frs2 T A 10: 117,074,582 S292C probably damaging Het
Gpr107 T A 2: 31,171,994 F145I probably benign Het
Gpr153 T A 4: 152,279,373 C83* probably null Het
H2-Q7 T G 17: 35,440,186 probably null Het
Hsp90b1 A T 10: 86,695,748 probably benign Het
Kcnk1 C A 8: 126,025,289 N211K probably damaging Het
Klb T C 5: 65,379,727 V800A probably benign Het
Lat2 T C 5: 134,606,783 Y59C probably damaging Het
Mlkl A T 8: 111,327,801 probably benign Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mtbp T A 15: 55,562,942 C93* probably null Het
Myo7a A G 7: 98,081,180 probably benign Het
Myt1 G A 2: 181,807,387 probably benign Het
Ogfrl1 T C 1: 23,375,754 Q224R possibly damaging Het
Olfr418 A G 1: 173,271,002 T276A probably benign Het
Olfr661 A T 7: 104,688,819 H268L probably damaging Het
Osbpl2 A G 2: 180,150,290 probably benign Het
Plb1 C T 5: 32,284,920 T252M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn T C 6: 92,189,693 T657A probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rps6kb2 C A 19: 4,157,883 S348I probably benign Het
Rsrp1 C T 4: 134,924,257 R111W unknown Het
Ryr3 T C 2: 112,732,982 T2933A probably benign Het
Scara5 A G 14: 65,731,019 D247G possibly damaging Het
Slc7a11 C T 3: 50,424,096 S231N probably benign Het
Sod2 A T 17: 13,010,564 N91Y probably damaging Het
Spesp1 A T 9: 62,272,685 S314T probably benign Het
St3gal1 C A 15: 67,113,687 M39I probably benign Het
Stat6 A T 10: 127,658,241 I646F probably damaging Het
Tdrd1 A T 19: 56,865,978 K1119* probably null Het
Thbs2 A G 17: 14,679,815 I600T probably benign Het
Tor1a A G 2: 30,963,838 V160A probably damaging Het
Trdmt1 T G 2: 13,523,438 D104A probably benign Het
Trim58 T C 11: 58,651,393 V393A probably benign Het
Trip4 C T 9: 65,884,918 probably benign Het
Trip6 T C 5: 137,310,821 E341G probably benign Het
Ttn T A 2: 76,715,195 I32595F probably damaging Het
Ubr4 T A 4: 139,428,028 probably null Het
Ush2a G A 1: 188,864,693 V3877I probably benign Het
Vmn1r29 G T 6: 58,307,732 G146C probably damaging Het
Vmn2r53 A G 7: 12,581,780 V704A probably benign Het
Vmn2r7 C T 3: 64,716,367 M268I probably benign Het
Wnt7b G A 15: 85,537,495 T248M probably damaging Het
Xab2 G A 8: 3,613,649 P394S possibly damaging Het
Zfp663 A G 2: 165,359,075 V13A probably damaging Het
Other mutations in Gm15448
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Gm15448 APN 7 3823089 missense probably damaging 1.00
IGL01675:Gm15448 APN 7 3822608 splice site probably benign
IGL02040:Gm15448 APN 7 3821517 splice site probably benign
IGL02547:Gm15448 APN 7 3821661 missense probably damaging 0.98
IGL02749:Gm15448 APN 7 3822625 missense probably damaging 1.00
IGL02822:Gm15448 APN 7 3816918 missense possibly damaging 0.50
IGL02883:Gm15448 APN 7 3822180 missense possibly damaging 0.95
IGL03140:Gm15448 APN 7 3823248 missense probably benign 0.00
IGL03185:Gm15448 APN 7 3823230 missense probably damaging 1.00
IGL03212:Gm15448 APN 7 3823133 missense probably benign 0.00
R0347:Gm15448 UTSW 7 3822874 missense probably damaging 1.00
R0652:Gm15448 UTSW 7 3822763 missense probably benign 0.02
R0668:Gm15448 UTSW 7 3822700 missense probably damaging 0.99
R0724:Gm15448 UTSW 7 3816872 missense possibly damaging 0.83
R1074:Gm15448 UTSW 7 3823070 missense probably damaging 1.00
R1339:Gm15448 UTSW 7 3822156 missense probably damaging 1.00
R1541:Gm15448 UTSW 7 3816989 missense probably damaging 1.00
R1570:Gm15448 UTSW 7 3823061 missense probably benign 0.45
R1880:Gm15448 UTSW 7 3824951 critical splice donor site probably null
R1892:Gm15448 UTSW 7 3824574 missense probably benign 0.15
R1909:Gm15448 UTSW 7 3822919 missense probably benign 0.31
R2881:Gm15448 UTSW 7 3825641 start codon destroyed probably null 0.98
R2967:Gm15448 UTSW 7 3822687 missense probably damaging 1.00
R2983:Gm15448 UTSW 7 3821575 missense probably damaging 1.00
R4213:Gm15448 UTSW 7 3821554 missense probably damaging 1.00
R4319:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4320:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4321:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4322:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4323:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4536:Gm15448 UTSW 7 3822252 missense probably benign 0.00
R4597:Gm15448 UTSW 7 3822155 missense possibly damaging 0.81
R4713:Gm15448 UTSW 7 3822681 nonsense probably null
R4725:Gm15448 UTSW 7 3821548 missense probably benign
R4934:Gm15448 UTSW 7 3822677 missense probably damaging 1.00
R4971:Gm15448 UTSW 7 3822806 missense probably benign 0.00
R5138:Gm15448 UTSW 7 3824557 nonsense probably null
R5805:Gm15448 UTSW 7 3822623 missense probably benign 0.15
R5824:Gm15448 UTSW 7 3824754 missense probably damaging 1.00
R5841:Gm15448 UTSW 7 3822899 nonsense probably null
R6027:Gm15448 UTSW 7 3824639 missense possibly damaging 0.94
R6214:Gm15448 UTSW 7 3821718 missense probably damaging 0.99
R6329:Gm15448 UTSW 7 3822851 missense probably damaging 1.00
R6429:Gm15448 UTSW 7 3822346 missense possibly damaging 0.63
R6650:Gm15448 UTSW 7 3816899 missense possibly damaging 0.83
R6681:Gm15448 UTSW 7 3822252 missense probably benign 0.00
R6961:Gm15448 UTSW 7 3825125 missense probably damaging 1.00
R6989:Gm15448 UTSW 7 3822164 missense possibly damaging 0.95
R7025:Gm15448 UTSW 7 3821262 nonsense probably null
R7071:Gm15448 UTSW 7 3821668 missense unknown
R7194:Gm15448 UTSW 7 3824793 missense
R7215:Gm15448 UTSW 7 3822311 missense unknown
R7580:Gm15448 UTSW 7 3824612 missense unknown
R7776:Gm15448 UTSW 7 3823247 missense unknown
R7863:Gm15448 UTSW 7 3824802 critical splice acceptor site probably null
R7909:Gm15448 UTSW 7 3821709 missense unknown
R7946:Gm15448 UTSW 7 3824802 critical splice acceptor site probably null
R7990:Gm15448 UTSW 7 3821709 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAGGAATGTGCCTTATGTCCAACC -3'
(R):5'- TCTGTCAGGAACCTAGTCTCTGCTC -3'

Sequencing Primer
(F):5'- GATCACCTCACCTGAGACTGTG -3'
(R):5'- TCCTAAGCAGGAGTGGACAC -3'
Posted On2014-08-26