Incidental Mutation 'R0614:Cdt1'
ID226000
Institutional Source Beutler Lab
Gene Symbol Cdt1
Ensembl Gene ENSMUSG00000006585
Gene Namechromatin licensing and DNA replication factor 1
Synonyms2610318F11Rik, Ris2
MMRRC Submission 038803-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R0614 (G1)
Quality Score54
Status Validated
Chromosome8
Chromosomal Location122568015-122573554 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122568137 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 28 (T28A)
Ref Sequence ENSEMBL: ENSMUSP00000006760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006760] [ENSMUST00000127664]
PDB Structure
Structure of the Cdt1 C-terminal domain [SOLUTION NMR]
Structure of C-terminal region of Cdt1 [SOLUTION NMR]
Crystal structure of Cdt1/geminin complex [X-RAY DIFFRACTION]
Crystal structure of cdt1 C terminal domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000006760
AA Change: T28A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000006760
Gene: ENSMUSG00000006585
AA Change: T28A

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
low complexity region 59 70 N/A INTRINSIC
low complexity region 72 108 N/A INTRINSIC
CDT1 199 362 3.68e-91 SMART
low complexity region 401 427 N/A INTRINSIC
Pfam:CDT1_C 431 525 1.4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212967
Meta Mutation Damage Score 0.0833 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the formation of the pre-replication complex that is necessary for DNA replication. The encoded protein can bind geminin, which prevents replication and may function to prevent this protein from initiating replication at inappropriate origins. Phosphorylation of this protein by cyclin A-dependent kinases results in degradation of the protein. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a small in-frame deletion in exon 2 are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,192,663 T137I probably benign Het
3110082I17Rik C T 5: 139,364,031 V88I possibly damaging Het
4930453N24Rik T A 16: 64,766,614 Q249L probably damaging Het
Akap2 C A 4: 57,856,720 A926E probably benign Het
Ap1g2 C T 14: 55,099,773 V702I probably benign Het
Armcx5 G A X: 135,746,815 E547K probably damaging Het
Asah2 C A 19: 32,016,728 V406L probably damaging Het
Atp8b1 T C 18: 64,533,587 probably benign Het
Axl C A 7: 25,774,163 R346L probably benign Het
Baz1a G A 12: 54,941,519 R282* probably null Het
Card14 A G 11: 119,322,827 N200S probably benign Het
Cep250 C T 2: 155,970,097 Q438* probably null Het
Dapk1 C A 13: 60,718,132 P181Q probably damaging Het
Dnah17 C T 11: 118,070,568 probably benign Het
Dph7 T C 2: 24,968,956 probably null Het
Edc4 A T 8: 105,889,396 D801V possibly damaging Het
Eif4g2 A G 7: 111,077,223 probably null Het
Eml2 T C 7: 19,202,591 L531P probably damaging Het
Ephb2 T C 4: 136,673,365 Y533C probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fsip2 A G 2: 82,977,533 K1399E probably benign Het
Hcls1 A G 16: 36,962,625 D446G probably damaging Het
Hif1a T A 12: 73,945,631 N787K probably damaging Het
Ints14 T C 9: 64,964,433 S18P probably benign Het
Kalrn A T 16: 33,993,670 probably benign Het
Llgl2 T A 11: 115,850,267 D502E probably damaging Het
Lrwd1 A G 5: 136,123,500 V570A probably damaging Het
Mga C G 2: 119,964,466 P2877R probably damaging Het
Mvd T C 8: 122,436,553 I313V probably benign Het
Myo15b C A 11: 115,882,913 P270T probably damaging Het
Naip1 C A 13: 100,444,200 V180L probably benign Het
Ofd1 T C X: 166,435,540 probably benign Het
Olfr1233 T A 2: 89,339,985 I106F probably damaging Het
Olfr1423 A T 19: 12,036,565 M59K possibly damaging Het
Olfr348 T A 2: 36,786,693 L56H probably damaging Het
Otogl G A 10: 107,798,355 P1420S probably benign Het
Pcnt C T 10: 76,420,316 V697M probably damaging Het
Plekha7 A T 7: 116,154,645 Y702* probably null Het
Plxnb3 A G X: 73,764,358 probably benign Het
Ptgis A G 2: 167,206,882 F405L probably damaging Het
Ptprk C T 10: 28,075,136 P19L probably damaging Het
Ptprt A G 2: 161,812,120 V530A possibly damaging Het
Rasgrp4 A T 7: 29,145,851 Y299F probably damaging Het
Slc39a11 T A 11: 113,523,626 probably null Het
Slc6a15 T A 10: 103,404,352 L312* probably null Het
Slf1 T A 13: 77,049,114 M794L probably benign Het
Sntg2 G A 12: 30,257,978 T236I possibly damaging Het
Stau1 T C 2: 166,950,806 Y413C probably damaging Het
Syne2 T G 12: 75,912,353 probably null Het
Tas2r104 A T 6: 131,685,202 N181K probably damaging Het
Tmem81 G A 1: 132,507,731 V92I probably benign Het
Trap1 A G 16: 4,060,751 probably benign Het
Trip12 T C 1: 84,757,761 E905G probably damaging Het
Usp2 C T 9: 44,092,492 R494* probably null Het
Vps13a G T 19: 16,652,694 R2692S probably damaging Het
Zfhx3 T C 8: 108,948,539 S2074P probably benign Het
Zfhx3 C G 8: 108,948,967 Y2216* probably null Het
Zfp423 A G 8: 87,782,114 F409S probably damaging Het
Zfp472 G A 17: 32,977,934 E328K possibly damaging Het
Zfp619 T A 7: 39,537,675 M1043K possibly damaging Het
Zfp940 T C 7: 29,846,246 I79V probably benign Het
Other mutations in Cdt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0014:Cdt1 UTSW 8 122572566 missense probably benign 0.00
R0494:Cdt1 UTSW 8 122572060 missense possibly damaging 0.64
R0645:Cdt1 UTSW 8 122572145 unclassified probably benign
R1699:Cdt1 UTSW 8 122569983 missense probably damaging 0.99
R1889:Cdt1 UTSW 8 122572052 missense possibly damaging 0.85
R3114:Cdt1 UTSW 8 122570482 nonsense probably null
R4243:Cdt1 UTSW 8 122571418 missense probably benign 0.04
R4532:Cdt1 UTSW 8 122571756 missense probably benign 0.00
R5496:Cdt1 UTSW 8 122570500 missense probably damaging 0.99
R5498:Cdt1 UTSW 8 122570500 missense probably damaging 0.99
R5501:Cdt1 UTSW 8 122570500 missense probably damaging 0.99
R5523:Cdt1 UTSW 8 122568093 missense possibly damaging 0.95
R5647:Cdt1 UTSW 8 122570208 missense possibly damaging 0.79
R6160:Cdt1 UTSW 8 122571368 missense probably benign 0.36
R6892:Cdt1 UTSW 8 122570212 missense probably damaging 1.00
R7001:Cdt1 UTSW 8 122572510 missense probably damaging 1.00
R7089:Cdt1 UTSW 8 122571980 missense probably damaging 1.00
R7214:Cdt1 UTSW 8 122568273 critical splice donor site probably null
R7583:Cdt1 UTSW 8 122570256 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCTTTGAGAACCTTACGCACCAC -3'
(R):5'- TACCCTCTGCCTACGTCAGCAATG -3'

Sequencing Primer
(F):5'- GGAGTCAAATAGTCTCCTGCC -3'
(R):5'- TACGTCAGCAATGCCCTG -3'
Posted On2014-08-26