Incidental Mutation 'R1017:Rsl1d1'
ID226008
Institutional Source Beutler Lab
Gene Symbol Rsl1d1
Ensembl Gene ENSMUSG00000005846
Gene Nameribosomal L1 domain containing 1
Synonyms
MMRRC Submission 039121-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R1017 (G1)
Quality Score44
Status Validated
Chromosome16
Chromosomal Location11192970-11203331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11203252 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 2 (K2E)
Ref Sequence ENSEMBL: ENSMUSP00000113431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119953] [ENSMUST00000230002]
Predicted Effect probably benign
Transcript: ENSMUST00000119953
AA Change: K2E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113431
Gene: ENSMUSG00000005846
AA Change: K2E

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:Ribosomal_L1 36 259 2.3e-52 PFAM
coiled coil region 281 313 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229756
Predicted Effect unknown
Transcript: ENSMUST00000230002
AA Change: K1E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230166
Predicted Effect probably benign
Transcript: ENSMUST00000230232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230245
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp C T 6: 125,061,260 probably benign Het
Ahnak A T 19: 9,010,543 I3064F probably damaging Het
Arhgef10l C A 4: 140,515,306 R884L probably damaging Het
Baiap2l2 A G 15: 79,261,243 F317L probably benign Het
Brinp2 A T 1: 158,249,451 I358N probably damaging Het
Ccin A G 4: 43,985,222 D543G probably benign Het
Cdh23 T A 10: 60,331,793 D1806V probably damaging Het
Cdh6 C T 15: 13,051,476 R357Q probably benign Het
Cpa3 T C 3: 20,239,633 M64V possibly damaging Het
Ctnnb1 T A 9: 120,950,728 F74I probably damaging Het
Cyp7a1 A T 4: 6,272,307 I302N probably damaging Het
Dnase1l2 C T 17: 24,442,472 A56T probably benign Het
Dscam T A 16: 96,833,433 D190V probably damaging Het
Fer1l4 T C 2: 156,049,478 probably null Het
Fscb T A 12: 64,473,468 D408V probably benign Het
Gm10306 A G 4: 94,556,720 probably benign Het
Gon4l T A 3: 88,858,496 M409K probably benign Het
Gsx2 T C 5: 75,077,262 S292P probably damaging Het
Hira T A 16: 18,899,347 probably null Het
Hoxa3 G T 6: 52,172,406 probably null Het
Irak3 T C 10: 120,142,884 E554G possibly damaging Het
Itgb3bp A G 4: 99,769,487 probably benign Het
Kifc3 C T 8: 95,105,785 D379N probably damaging Het
Lama5 A G 2: 180,195,420 V1032A probably damaging Het
Lmln T G 16: 33,088,176 I324R probably benign Het
Ltbp4 A G 7: 27,306,076 S1547P possibly damaging Het
Mdga1 T A 17: 29,850,548 T175S probably damaging Het
Mrps6 T A 16: 92,058,458 L8* probably null Het
Mtmr11 A C 3: 96,164,477 T203P probably damaging Het
Nat8f7 T C 6: 85,707,570 D96G probably damaging Het
Obscn T C 11: 58,998,353 E7531G unknown Het
Olfr1061 A T 2: 86,413,511 D180E probably damaging Het
Olfr1065 A T 2: 86,445,428 L185I probably benign Het
Olfr267 A T 4: 58,785,115 S202R probably damaging Het
Osbpl6 A G 2: 76,549,719 Y69C probably damaging Het
Polrmt C T 10: 79,743,509 W136* probably null Het
Raver1 T C 9: 21,079,590 probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Sik3 C T 9: 46,195,809 T417I probably benign Het
Spdl1 T C 11: 34,819,290 K388R possibly damaging Het
Tulp1 T C 17: 28,364,303 R88G probably damaging Het
Vldlr A C 19: 27,241,333 Y528S probably damaging Het
Zdhhc14 T A 17: 5,493,649 L68H probably damaging Het
Zfp605 C T 5: 110,127,994 T326I probably benign Het
Other mutations in Rsl1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Rsl1d1 APN 16 11199694 missense probably damaging 1.00
IGL01087:Rsl1d1 APN 16 11194675 missense possibly damaging 0.85
IGL01998:Rsl1d1 APN 16 11194645 missense possibly damaging 0.79
IGL02077:Rsl1d1 APN 16 11194456 unclassified probably benign
IGL02627:Rsl1d1 APN 16 11194551 missense possibly damaging 0.48
R0925:Rsl1d1 UTSW 16 11199689 missense probably damaging 1.00
R1671:Rsl1d1 UTSW 16 11201381 missense probably damaging 1.00
R4658:Rsl1d1 UTSW 16 11201374 missense probably damaging 1.00
R4915:Rsl1d1 UTSW 16 11199729 splice site probably null
R5265:Rsl1d1 UTSW 16 11201384 missense possibly damaging 0.82
R5545:Rsl1d1 UTSW 16 11199650 missense probably damaging 0.99
R6221:Rsl1d1 UTSW 16 11201311 missense probably damaging 0.99
R6970:Rsl1d1 UTSW 16 11193694 missense probably benign 0.06
R7852:Rsl1d1 UTSW 16 11203234 missense probably benign
R7919:Rsl1d1 UTSW 16 11202433 missense probably benign 0.18
Z1088:Rsl1d1 UTSW 16 11202385 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACGGACACATGACCTGTGATGC -3'
(R):5'- AAGGAGATGCTGCCGCTAGAATAAC -3'

Sequencing Primer
(F):5'- TTTCCACAGGAGGCAAACAG -3'
(R):5'- TAACTCTGGGCACAGTCTACG -3'
Posted On2014-08-29