Incidental Mutation 'R0751:Plxnc1'
ID226014
Institutional Source Beutler Lab
Gene Symbol Plxnc1
Ensembl Gene ENSMUSG00000074785
Gene Nameplexin C1
SynonymsCD232, vespr, 2510048K12Rik
MMRRC Submission 038931-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.662) question?
Stock #R0751 (G1)
Quality Score71
Status Validated
Chromosome10
Chromosomal Location94790866-94944835 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 94831333 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099337]
Predicted Effect probably benign
Transcript: ENSMUST00000099337
SMART Domains Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Sema 87 431 5.5e-10 PFAM
PSI 454 507 5.28e-12 SMART
PSI 590 634 1.07e-3 SMART
Pfam:TIG 665 752 3.7e-9 PFAM
IPT 755 847 5.14e-7 SMART
IPT 849 954 1.8e-2 SMART
low complexity region 978 997 N/A INTRINSIC
Pfam:Plexin_cytopl 1018 1541 1.4e-199 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218839
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin family. Plexins are transmembrane receptors for semaphorins, a large family of proteins that regulate axon guidance, cell motility and migration, and the immune response. The encoded protein and its ligand regulate melanocyte adhesion, and viral semaphorins may modulate the immune response by binding to this receptor. The encoded protein may be a tumor suppressor protein for melanoma. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron morphology and migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 T A 4: 133,065,396 M1316K probably benign Het
Alox12 T C 11: 70,246,950 I455V probably benign Het
Ankrd28 A G 14: 31,764,268 L89P probably damaging Het
Aqp9 A T 9: 71,138,205 C41S probably damaging Het
Arhgap17 T C 7: 123,314,690 Y199C probably damaging Het
Aspm A T 1: 139,456,898 probably benign Het
Cacfd1 T C 2: 27,018,981 probably null Het
Cd33 T C 7: 43,532,121 D205G probably damaging Het
Chadl T C 15: 81,693,057 S198G probably benign Het
Chtf8 A G 8: 106,886,477 probably null Het
Clec4a4 G T 6: 123,012,712 W104L probably benign Het
Clock A T 5: 76,229,361 I696K possibly damaging Het
Crtc2 T A 3: 90,262,633 Y445* probably null Het
Dapk1 A T 13: 60,696,298 I44F probably damaging Het
Dcbld2 T A 16: 58,449,841 probably null Het
Derl2 T C 11: 71,014,547 probably null Het
Dnah7c A G 1: 46,465,905 T154A probably benign Het
Dnmt3b T A 2: 153,674,842 probably null Het
Dusp3 A T 11: 101,981,728 S106T probably benign Het
Eftud2 A G 11: 102,839,253 V897A probably damaging Het
Eif3l T A 15: 79,075,766 probably null Het
Fbxo33 A C 12: 59,219,092 F130V probably damaging Het
Ffar3 T A 7: 30,855,104 N264Y probably damaging Het
Fig4 T C 10: 41,272,982 D158G probably damaging Het
Fyco1 A G 9: 123,819,153 F1239L probably damaging Het
Gabra2 A G 5: 71,092,099 probably benign Het
Gabra6 C A 11: 42,315,017 R336S probably benign Het
Gm9268 A G 7: 43,047,409 Y630C probably damaging Het
Hkdc1 T C 10: 62,398,673 D581G probably damaging Het
Iqgap1 A G 7: 80,725,573 probably benign Het
Larp4b T C 13: 9,166,309 probably benign Het
Lcp1 A T 14: 75,199,387 M58L probably benign Het
Lrrc8a T C 2: 30,256,350 V392A possibly damaging Het
Mavs A T 2: 131,246,764 Y496F probably damaging Het
Mpi A T 9: 57,550,614 S102T probably damaging Het
Mroh9 G A 1: 163,066,124 R161W possibly damaging Het
Myo1h A T 5: 114,320,686 S161C probably damaging Het
Napg T G 18: 62,994,338 H204Q probably benign Het
Nelfcd C A 2: 174,423,014 A182D probably benign Het
Ntsr2 G T 12: 16,654,030 K91N probably damaging Het
Obscn A G 11: 59,081,819 S2134P probably damaging Het
Ogfod2 G A 5: 124,113,476 probably benign Het
Olfr385 G T 11: 73,589,144 T198K probably benign Het
Olfr525 G A 7: 140,323,325 V209I probably benign Het
Pcdha8 T C 18: 36,994,070 V535A probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pik3r1 T C 13: 101,686,358 probably null Het
Pimreg C A 11: 72,043,113 Q22K probably benign Het
Pld5 A G 1: 176,044,896 I225T probably damaging Het
Ppip5k2 A T 1: 97,749,652 C306* probably null Het
Ptprc A G 1: 138,092,930 Y588H probably damaging Het
Rac2 T G 15: 78,565,945 D65A possibly damaging Het
Rgl3 A G 9: 21,977,380 probably null Het
Serpinb1a T C 13: 32,843,216 K248E probably benign Het
Serpinb9e A C 13: 33,259,774 E259A probably benign Het
Slc12a4 A T 8: 105,951,900 V266E probably damaging Het
Slc8b1 A G 5: 120,524,195 probably benign Het
Smim4 G T 14: 31,088,996 probably benign Het
Spink6 T C 18: 44,071,538 probably benign Het
Spta1 G A 1: 174,184,690 R354H probably damaging Het
Ssb T A 2: 69,870,565 S330T probably benign Het
Stard9 G T 2: 120,697,485 V1408F probably benign Het
Sumf2 A T 5: 129,850,005 T61S probably benign Het
Sypl2 T C 3: 108,216,756 T157A probably damaging Het
Tgfbr3 A T 5: 107,139,883 D483E probably damaging Het
Tnrc6a A G 7: 123,170,340 N451S possibly damaging Het
Tradd T C 8: 105,259,771 E123G probably damaging Het
Trim36 T C 18: 46,196,251 T41A probably damaging Het
Ttc30a2 C T 2: 75,978,031 A46T probably damaging Het
Ttll7 C T 3: 146,939,991 P535S probably damaging Het
Ubr4 C T 4: 139,437,198 probably benign Het
Vmn1r195 A G 13: 22,279,011 Y217C probably damaging Het
Vmn2r63 A C 7: 42,928,035 F360V probably damaging Het
Vmn2r78 G A 7: 86,954,380 V589M possibly damaging Het
Vrk2 A G 11: 26,483,331 probably benign Het
Other mutations in Plxnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Plxnc1 APN 10 94847549 missense probably benign 0.25
IGL01285:Plxnc1 APN 10 94799368 missense probably damaging 0.99
IGL01867:Plxnc1 APN 10 94798146 missense possibly damaging 0.61
IGL01994:Plxnc1 APN 10 94849939 missense probably damaging 1.00
IGL02083:Plxnc1 APN 10 94922725 missense possibly damaging 0.61
IGL02250:Plxnc1 APN 10 94871031 missense probably benign 0.00
IGL02429:Plxnc1 APN 10 94882591 missense probably benign 0.00
IGL02752:Plxnc1 APN 10 94794680 unclassified probably null
IGL02973:Plxnc1 APN 10 94810684 missense probably damaging 1.00
R0230:Plxnc1 UTSW 10 94799347 missense probably benign 0.07
R0265:Plxnc1 UTSW 10 94813129 missense probably benign 0.14
R0271:Plxnc1 UTSW 10 94837918 missense probably null 1.00
R0299:Plxnc1 UTSW 10 94849821 critical splice donor site probably null
R0361:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
R0441:Plxnc1 UTSW 10 94796482 missense probably damaging 1.00
R0558:Plxnc1 UTSW 10 94837935 missense probably damaging 1.00
R0617:Plxnc1 UTSW 10 94799368 missense probably damaging 1.00
R0671:Plxnc1 UTSW 10 94799332 missense possibly damaging 0.63
R0692:Plxnc1 UTSW 10 94837500 critical splice donor site probably null
R1184:Plxnc1 UTSW 10 94831333 splice site probably benign
R1260:Plxnc1 UTSW 10 94831365 missense probably damaging 0.99
R1680:Plxnc1 UTSW 10 94841551 missense probably benign 0.14
R1746:Plxnc1 UTSW 10 94844179 splice site probably null
R1750:Plxnc1 UTSW 10 94799497 missense probably damaging 1.00
R1751:Plxnc1 UTSW 10 94849815 unclassified probably benign
R1768:Plxnc1 UTSW 10 94844322 missense probably benign 0.05
R1876:Plxnc1 UTSW 10 94866941 missense possibly damaging 0.94
R2004:Plxnc1 UTSW 10 94852622 missense probably damaging 0.98
R2031:Plxnc1 UTSW 10 94943667 missense probably benign 0.26
R2184:Plxnc1 UTSW 10 94944269 missense probably damaging 1.00
R2437:Plxnc1 UTSW 10 94906533 missense probably benign 0.02
R2927:Plxnc1 UTSW 10 94793292 critical splice acceptor site probably null
R3001:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3002:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3003:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3441:Plxnc1 UTSW 10 94871010 missense probably benign 0.00
R3849:Plxnc1 UTSW 10 94794432 missense probably benign 0.01
R3884:Plxnc1 UTSW 10 94910687 intron probably null
R4004:Plxnc1 UTSW 10 94794597 nonsense probably null
R4679:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
R4730:Plxnc1 UTSW 10 94867468 intron probably benign
R4937:Plxnc1 UTSW 10 94841473 missense probably damaging 1.00
R5068:Plxnc1 UTSW 10 94799377 missense possibly damaging 0.91
R5345:Plxnc1 UTSW 10 94849969 missense probably benign 0.26
R5397:Plxnc1 UTSW 10 94843752 missense probably benign 0.08
R5416:Plxnc1 UTSW 10 94837554 missense probably damaging 1.00
R5485:Plxnc1 UTSW 10 94922742 missense probably benign 0.00
R5543:Plxnc1 UTSW 10 94864774 missense probably benign
R5826:Plxnc1 UTSW 10 94799473 critical splice donor site probably null
R6007:Plxnc1 UTSW 10 94793290 missense possibly damaging 0.88
R6018:Plxnc1 UTSW 10 94943848 missense probably benign 0.21
R6052:Plxnc1 UTSW 10 94943773 missense probably benign 0.13
R6291:Plxnc1 UTSW 10 94833642 splice site probably null
R6653:Plxnc1 UTSW 10 94943876 missense probably damaging 1.00
R6984:Plxnc1 UTSW 10 94831530 missense probably damaging 1.00
R7086:Plxnc1 UTSW 10 94831435 missense probably benign
R7401:Plxnc1 UTSW 10 94871005 missense probably benign
R7727:Plxnc1 UTSW 10 94944109 missense probably damaging 1.00
R7789:Plxnc1 UTSW 10 94794477 missense probably damaging 1.00
R7803:Plxnc1 UTSW 10 94943515 critical splice donor site probably null
R7809:Plxnc1 UTSW 10 94794440 missense probably damaging 1.00
R7882:Plxnc1 UTSW 10 94843836 missense probably benign
R7965:Plxnc1 UTSW 10 94843836 missense probably benign
RF003:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
RF045:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF046:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF047:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
X0024:Plxnc1 UTSW 10 94864715 critical splice donor site probably null
Z1176:Plxnc1 UTSW 10 94865029 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCCAGTGTGCCAGTGAGTAATGAG -3'
(R):5'- TGCAAACCAAACTGGTCTACCTGAC -3'

Sequencing Primer
(F):5'- GGACTCAAGAACAGTTTGTGCTC -3'
(R):5'- TACCTGACCAGCATCCTGGAG -3'
Posted On2014-09-03