Incidental Mutation 'R1018:Cnn2'
ID226016
Institutional Source Beutler Lab
Gene Symbol Cnn2
Ensembl Gene ENSMUSG00000004665
Gene Namecalponin 2
Synonymsh2-calponin, Calpo2
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R1018 (G1)
Quality Score29
Status Validated
Chromosome10
Chromosomal Location79988584-79996062 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79993563 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 176 (C176R)
Ref Sequence ENSEMBL: ENSMUSP00000101013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004784] [ENSMUST00000043866] [ENSMUST00000105374] [ENSMUST00000132517] [ENSMUST00000171637]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004784
AA Change: C215R

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000004784
Gene: ENSMUSG00000004665
AA Change: C215R

DomainStartEndE-ValueType
CH 30 127 1.82e-22 SMART
Pfam:Calponin 166 190 6e-20 PFAM
Pfam:Calponin 206 230 6e-20 PFAM
Pfam:Calponin 245 268 2.6e-10 PFAM
low complexity region 276 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043866
SMART Domains Protein: ENSMUSP00000043090
Gene: ENSMUSG00000035722

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105374
AA Change: C176R

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101013
Gene: ENSMUSG00000004665
AA Change: C176R

DomainStartEndE-ValueType
CH 30 127 1.82e-22 SMART
Pfam:Calponin 130 152 7.6e-15 PFAM
Pfam:Calponin 167 192 4.1e-16 PFAM
Pfam:Calponin 206 230 6.4e-15 PFAM
low complexity region 237 255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132517
SMART Domains Protein: ENSMUSP00000115111
Gene: ENSMUSG00000035722

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171637
SMART Domains Protein: ENSMUSP00000128121
Gene: ENSMUSG00000035722

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 517 747 2.8e-19 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1249 1271 N/A INTRINSIC
low complexity region 1307 1317 N/A INTRINSIC
low complexity region 1382 1398 N/A INTRINSIC
Pfam:ABC2_membrane_3 1426 1772 3.9e-47 PFAM
AAA 1841 2026 7.2e-9 SMART
low complexity region 2128 2143 N/A INTRINSIC
Meta Mutation Damage Score 0.6404 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, which can bind actin, calmodulin, troponin C, and tropomyosin, may function in the structural organization of actin filaments. The encoded protein could play a role in smooth muscle contraction and cell adhesion. Several pseudogenes of this gene have been identified, and are present on chromosomes 1, 2, 3, 6, 9, 11, 13, 15, 16, 21 and 22. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for either a knock-out or a knock-down allele have reduced numbers of peripheral blood neutrophils and monocytes. Knock-out mice show increased macrophage proliferation, motility and phagocytosis, faster diapedesis of peripheral monocytesand neutrophils, and enhanced wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Cnn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Cnn2 APN 10 79992554 missense probably benign 0.01
IGL02715:Cnn2 APN 10 79993489 missense probably damaging 1.00
R1294:Cnn2 UTSW 10 79993525 missense probably damaging 0.96
R1346:Cnn2 UTSW 10 79993580 unclassified probably benign
R2302:Cnn2 UTSW 10 79991399 missense possibly damaging 0.75
R3802:Cnn2 UTSW 10 79993495 missense probably benign 0.25
R4452:Cnn2 UTSW 10 79991442 missense probably benign
R6166:Cnn2 UTSW 10 79988727 missense possibly damaging 0.67
R7156:Cnn2 UTSW 10 79994515 nonsense probably null
R7465:Cnn2 UTSW 10 79992527 missense probably damaging 1.00
X0025:Cnn2 UTSW 10 79992278 missense probably benign 0.06
X0064:Cnn2 UTSW 10 79994387 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGGAACTTTGACGACGCCAC -3'
(R):5'- ACTATCTCCTTCTGAGGTCCCCAAAAC -3'

Sequencing Primer
(F):5'- AAGGTTTGGAGCCTGCC -3'
(R):5'- GAGGTCCCCAAAACCTCAGTG -3'
Posted On2014-09-05