Incidental Mutation 'R0762:Aldh3b3'
ID226021
Institutional Source Beutler Lab
Gene Symbol Aldh3b3
Ensembl Gene ENSMUSG00000037263
Gene Namealdehyde dehydrogenase 3 family, member B3
Synonyms1700055N04Rik
MMRRC Submission 038942-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R0762 (G1)
Quality Score67
Status Validated
Chromosome19
Chromosomal Location3958645-3972103 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 3965747 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000179433] [ENSMUST00000189124]
Predicted Effect probably null
Transcript: ENSMUST00000025794
SMART Domains Protein: ENSMUSP00000025794
Gene: ENSMUSG00000037263

DomainStartEndE-ValueType
PDB:4L2O|G 1 87 5e-22 PDB
SCOP:d1ad3a_ 8 82 2e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179433
AA Change: Q239L

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000136334
Gene: ENSMUSG00000037263
AA Change: Q239L

DomainStartEndE-ValueType
Pfam:Aldedh 6 441 5.4e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189124
SMART Domains Protein: ENSMUSP00000140893
Gene: ENSMUSG00000037263

DomainStartEndE-ValueType
SCOP:d1ad3a_ 18 72 2e-8 SMART
PDB:1AD3|B 19 67 1e-8 PDB
Meta Mutation Damage Score 0.1913 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 93.9%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,218,416 probably benign Het
4921504E06Rik T A 2: 19,477,856 N475I probably damaging Het
Adar T C 3: 89,739,983 probably benign Het
Amtn C T 5: 88,385,000 T158I possibly damaging Het
Ap1g2 A G 14: 55,100,411 probably benign Het
Arhgef3 A G 14: 27,397,627 Y318C probably damaging Het
Atg2b A C 12: 105,674,970 V69G possibly damaging Het
Bbx G A 16: 50,225,166 T236I possibly damaging Het
Bcl11b C T 12: 107,965,663 probably benign Het
Catsperg1 T C 7: 29,189,952 I794V probably benign Het
Ccdc88a C T 11: 29,463,112 probably benign Het
Cdhr3 C A 12: 33,060,301 R328L probably benign Het
Ces2e T A 8: 104,929,864 M242K probably damaging Het
Col12a1 A G 9: 79,681,374 probably benign Het
Col3a1 T C 1: 45,321,526 S39P unknown Het
Cyp2a5 T A 7: 26,838,873 Y220* probably null Het
D3Ertd254e G A 3: 36,165,867 D680N possibly damaging Het
Dcc T A 18: 71,342,705 probably benign Het
Dnajb8 A G 6: 88,223,054 T191A probably damaging Het
Ephx2 A T 14: 66,102,179 F199I probably damaging Het
Fancd2 A G 6: 113,574,658 K1062E probably benign Het
Fbxo33 A G 12: 59,204,499 V410A probably benign Het
Gars T G 6: 55,077,580 probably null Het
Git1 A C 11: 77,499,834 D132A possibly damaging Het
Gm853 A G 4: 130,221,624 S44P probably damaging Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Gucy1a1 T C 3: 82,094,896 T44A unknown Het
Hjurp G C 1: 88,277,215 probably benign Het
Ifnlr1 A G 4: 135,701,329 K156E possibly damaging Het
Klf13 T C 7: 63,891,623 N15S probably benign Het
Krt77 T C 15: 101,861,126 probably null Het
Map4 C A 9: 110,038,478 probably benign Het
Mthfr T C 4: 148,055,443 I623T possibly damaging Het
Myo7b T A 18: 31,983,944 T908S probably benign Het
Nbeal2 T G 9: 110,643,808 probably benign Het
Nwd2 T G 5: 63,800,414 F362L probably benign Het
Pcm1 A T 8: 41,261,020 R208W probably damaging Het
Pkd2l1 T C 19: 44,150,470 D647G probably benign Het
Plbd1 C T 6: 136,641,147 V24M probably damaging Het
Polr2a G A 11: 69,735,117 P1698S unknown Het
Prss12 T C 3: 123,485,504 I410T probably damaging Het
Ptpre A G 7: 135,679,235 N565S probably damaging Het
Rab44 T C 17: 29,145,270 L606P unknown Het
Rbm10 C T X: 20,637,664 probably benign Het
Rhd C T 4: 134,876,301 probably benign Het
Rspo3 T A 10: 29,499,921 probably benign Het
Sdccag8 T A 1: 176,946,144 N555K probably benign Het
Skint6 T A 4: 112,865,651 probably benign Het
Slc22a20 G A 19: 5,986,008 P45S probably damaging Het
Slc5a2 A G 7: 128,267,482 Y124C probably damaging Het
Spats2l T C 1: 57,885,884 L127P possibly damaging Het
Taar8a T A 10: 24,077,077 I193N probably benign Het
Ten1 C T 11: 116,216,684 probably benign Het
Tfb2m T C 1: 179,545,833 E100G probably damaging Het
Tom1 C T 8: 75,052,306 probably benign Het
Vps52 G T 17: 33,960,011 R171L probably damaging Het
Zcwpw2 A T 9: 118,014,114 noncoding transcript Het
Zfhx4 G A 3: 5,403,820 E3013K probably damaging Het
Zfp777 C T 6: 48,029,360 V411M probably damaging Het
Other mutations in Aldh3b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Aldh3b3 APN 19 3965863 missense probably benign 0.02
R0395:Aldh3b3 UTSW 19 3966472 missense probably benign 0.00
R1722:Aldh3b3 UTSW 19 3964871 missense possibly damaging 0.76
R1754:Aldh3b3 UTSW 19 3968517 missense probably benign
R1853:Aldh3b3 UTSW 19 3965822 missense probably damaging 1.00
R1901:Aldh3b3 UTSW 19 3965130 missense probably damaging 1.00
R3924:Aldh3b3 UTSW 19 3968491 missense probably damaging 1.00
R4578:Aldh3b3 UTSW 19 3964832 missense probably benign
R4689:Aldh3b3 UTSW 19 3964516 missense probably damaging 0.97
R5632:Aldh3b3 UTSW 19 3968522 utr 3 prime probably benign
R5635:Aldh3b3 UTSW 19 3968512 missense probably benign 0.17
R7422:Aldh3b3 UTSW 19 3966476 missense probably benign 0.01
R7478:Aldh3b3 UTSW 19 3964549 missense probably benign 0.36
R7481:Aldh3b3 UTSW 19 3964549 missense probably benign 0.36
R7717:Aldh3b3 UTSW 19 3963970 missense probably damaging 1.00
R7863:Aldh3b3 UTSW 19 3965322 nonsense probably null
R7868:Aldh3b3 UTSW 19 3968492 nonsense probably null
R7895:Aldh3b3 UTSW 19 3964871 missense possibly damaging 0.76
R7946:Aldh3b3 UTSW 19 3965322 nonsense probably null
R7951:Aldh3b3 UTSW 19 3968492 nonsense probably null
R7978:Aldh3b3 UTSW 19 3964871 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AAGGTAATGCTAGTTGACCAGGTGC -3'
(R):5'- TCAGGGACAGGAGACTCACCAATG -3'

Sequencing Primer
(F):5'- CCTCTTGACCATGTTCTCAGGAAG -3'
(R):5'- AATCCCTGGAGCCTCTTGAAATG -3'
Posted On2014-09-08