Incidental Mutation 'R1004:Nup58'
ID 226025
Institutional Source Beutler Lab
Gene Symbol Nup58
Ensembl Gene ENSMUSG00000063895
Gene Name nucleoporin 58
Synonyms Nupl1, 1700017F11Rik
MMRRC Submission 039114-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.945) question?
Stock # R1004 (G1)
Quality Score 23
Status Validated
Chromosome 14
Chromosomal Location 60442733-60488951 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 60484930 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041905] [ENSMUST00000225111] [ENSMUST00000225311] [ENSMUST00000225805]
AlphaFold Q8R332
Predicted Effect probably benign
Transcript: ENSMUST00000041905
SMART Domains Protein: ENSMUSP00000038716
Gene: ENSMUSG00000114797

DomainStartEndE-ValueType
Pfam:Nucleoporin_FG2 3 587 1.5e-299 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225111
Predicted Effect probably benign
Transcript: ENSMUST00000225311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225572
Predicted Effect probably benign
Transcript: ENSMUST00000225805
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleoporin family that shares 87% sequence identity with rat nucleoporin p58. The protein is localized to the nuclear rim and is a component of the nuclear pore complex (NPC). All molecules entering or leaving the nucleus either diffuse through or are actively transported by the NPC. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,042,780 (GRCm39) I423T possibly damaging Het
Agbl3 A T 6: 34,780,386 (GRCm39) E453V probably damaging Het
Agxt A G 1: 93,063,421 (GRCm39) M108V possibly damaging Het
Akap13 T C 7: 75,337,034 (GRCm39) I831T probably damaging Het
Anpep C T 7: 79,488,004 (GRCm39) E518K probably benign Het
Arid1a A G 4: 133,414,586 (GRCm39) M1215T unknown Het
Cd163 G T 6: 124,302,306 (GRCm39) D957Y probably damaging Het
Ces2e A G 8: 105,656,370 (GRCm39) D200G probably damaging Het
Cfap54 T C 10: 92,902,558 (GRCm39) probably benign Het
Col11a1 A G 3: 113,888,671 (GRCm39) probably benign Het
Dlx6 C T 6: 6,863,665 (GRCm39) Q96* probably null Het
Dpp4 T A 2: 62,162,984 (GRCm39) Q754L probably benign Het
Ece1 A G 4: 137,653,550 (GRCm39) T100A probably benign Het
Gabbr2 C T 4: 46,677,544 (GRCm39) V779M possibly damaging Het
Gatm C T 2: 122,440,141 (GRCm39) probably benign Het
Gpc2 A G 5: 138,276,487 (GRCm39) L213P probably damaging Het
Hook1 A C 4: 95,910,524 (GRCm39) N713H probably benign Het
Kdm5b T A 1: 134,516,642 (GRCm39) I178K possibly damaging Het
Mettl9 G A 7: 120,675,460 (GRCm39) V287I probably benign Het
Mroh2a C A 1: 88,170,142 (GRCm39) A685D possibly damaging Het
Mycbp2 G A 14: 103,378,353 (GRCm39) T3774I probably benign Het
Nxf1 A T 19: 8,741,681 (GRCm39) T119S probably benign Het
Oaz3 T A 3: 94,342,350 (GRCm39) H102L probably damaging Het
Or8g2b T C 9: 39,751,276 (GRCm39) F182S probably benign Het
Pfpl A T 19: 12,407,789 (GRCm39) Q680L probably benign Het
Poli T A 18: 70,658,509 (GRCm39) Q75L probably benign Het
Ppp2r3d C T 9: 101,075,829 (GRCm39) probably null Het
Prr30 A G 14: 101,436,529 (GRCm39) L11P probably damaging Het
Ptchd4 A T 17: 42,688,493 (GRCm39) Y345F probably benign Het
Ric1 A G 19: 29,579,757 (GRCm39) N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,518,225 (GRCm39) probably benign Het
Sh3bgrl2 C T 9: 83,459,684 (GRCm39) probably benign Het
Skp1 G C 11: 52,128,207 (GRCm39) probably benign Het
Slc12a9 T C 5: 137,320,786 (GRCm39) K528R probably damaging Het
Slc22a6 A G 19: 8,595,763 (GRCm39) N35S probably damaging Het
Tcstv2c T A 13: 120,616,558 (GRCm39) D132E probably benign Het
Xrcc5 A G 1: 72,422,937 (GRCm39) probably benign Het
Zfp235 T A 7: 23,840,169 (GRCm39) L266Q probably damaging Het
Zfp600 T A 4: 146,133,103 (GRCm39) probably benign Het
Other mutations in Nup58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Nup58 APN 14 60,480,026 (GRCm39) missense probably benign 0.01
IGL00693:Nup58 APN 14 60,475,969 (GRCm39) missense probably benign 0.10
IGL00725:Nup58 APN 14 60,480,889 (GRCm39) missense possibly damaging 0.84
IGL00969:Nup58 APN 14 60,466,365 (GRCm39) splice site probably benign
IGL03243:Nup58 APN 14 60,459,065 (GRCm39) missense probably benign 0.06
IGL03351:Nup58 APN 14 60,466,224 (GRCm39) missense probably benign 0.19
R0056:Nup58 UTSW 14 60,476,924 (GRCm39) splice site probably null
R0113:Nup58 UTSW 14 60,488,740 (GRCm39) start gained probably benign
R0201:Nup58 UTSW 14 60,482,065 (GRCm39) missense probably benign 0.32
R0830:Nup58 UTSW 14 60,480,931 (GRCm39) missense probably damaging 1.00
R0925:Nup58 UTSW 14 60,457,590 (GRCm39) missense probably damaging 0.99
R1178:Nup58 UTSW 14 60,482,119 (GRCm39) splice site probably benign
R1181:Nup58 UTSW 14 60,482,119 (GRCm39) splice site probably benign
R1268:Nup58 UTSW 14 60,482,119 (GRCm39) splice site probably benign
R1388:Nup58 UTSW 14 60,482,119 (GRCm39) splice site probably benign
R1411:Nup58 UTSW 14 60,482,119 (GRCm39) splice site probably benign
R1442:Nup58 UTSW 14 60,469,992 (GRCm39) splice site probably benign
R1626:Nup58 UTSW 14 60,480,076 (GRCm39) nonsense probably null
R1697:Nup58 UTSW 14 60,482,119 (GRCm39) splice site probably benign
R1756:Nup58 UTSW 14 60,482,119 (GRCm39) splice site probably benign
R1853:Nup58 UTSW 14 60,481,996 (GRCm39) missense possibly damaging 0.81
R1915:Nup58 UTSW 14 60,475,980 (GRCm39) missense probably benign 0.00
R2160:Nup58 UTSW 14 60,476,957 (GRCm39) missense probably benign 0.15
R2211:Nup58 UTSW 14 60,470,089 (GRCm39) missense probably damaging 0.99
R2213:Nup58 UTSW 14 60,476,945 (GRCm39) missense probably benign 0.01
R2518:Nup58 UTSW 14 60,470,109 (GRCm39) missense probably damaging 1.00
R2519:Nup58 UTSW 14 60,460,808 (GRCm39) missense probably benign 0.23
R3914:Nup58 UTSW 14 60,469,596 (GRCm39) missense possibly damaging 0.76
R4302:Nup58 UTSW 14 60,484,875 (GRCm39) missense probably benign 0.44
R4626:Nup58 UTSW 14 60,476,004 (GRCm39) missense probably benign 0.24
R4705:Nup58 UTSW 14 60,488,664 (GRCm39) missense unknown
R4772:Nup58 UTSW 14 60,457,471 (GRCm39) missense probably benign 0.00
R6151:Nup58 UTSW 14 60,482,065 (GRCm39) missense possibly damaging 0.71
R6187:Nup58 UTSW 14 60,478,256 (GRCm39) splice site probably null
R6546:Nup58 UTSW 14 60,460,672 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- TTCCTCCTAGAGTAAATCCAGTGGCAG -3'
(R):5'- GCCTCCCAAATAGCTAACAGGTTCAG -3'

Sequencing Primer
(F):5'- TAAATCCAGTGGCAGGCTTAG -3'
(R):5'- ttttaaGGAGAAAAGGAAGGTGTTTG -3'
Posted On 2014-09-08