Incidental Mutation 'R0691:Cntn3'
ID 226036
Institutional Source Beutler Lab
Gene Symbol Cntn3
Ensembl Gene ENSMUSG00000030075
Gene Name contactin 3
Synonyms Pang
MMRRC Submission 038876-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0691 (G1)
Quality Score 58
Status Validated
Chromosome 6
Chromosomal Location 102140265-102541575 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102145908 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 978 (T978A)
Ref Sequence ENSEMBL: ENSMUSP00000145176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032159] [ENSMUST00000203619]
AlphaFold Q07409
Predicted Effect possibly damaging
Transcript: ENSMUST00000032159
AA Change: T978A

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032159
Gene: ENSMUSG00000030075
AA Change: T978A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 1.85e-7 SMART
IG 129 217 1.82e-6 SMART
IGc2 240 304 6.8e-15 SMART
IGc2 330 393 1.74e-12 SMART
IGc2 422 486 1.53e-8 SMART
IG 506 595 5.2e-11 SMART
FN3 598 684 3.4e-13 SMART
FN3 701 787 5.36e-2 SMART
FN3 803 888 4.63e-6 SMART
FN3 903 983 1.07e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000203619
AA Change: T978A

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145176
Gene: ENSMUSG00000030075
AA Change: T978A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 1.85e-7 SMART
IG 129 217 1.82e-6 SMART
IGc2 240 304 6.8e-15 SMART
IGc2 330 393 1.74e-12 SMART
IGc2 422 486 1.53e-8 SMART
IG 506 595 5.2e-11 SMART
FN3 598 684 3.4e-13 SMART
FN3 701 787 5.36e-2 SMART
FN3 803 888 4.63e-6 SMART
FN3 903 983 1.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204990
Meta Mutation Damage Score 0.0959 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,584,979 (GRCm39) D865G possibly damaging Het
Acy1 A T 9: 106,313,070 (GRCm39) probably null Het
Adcy4 A T 14: 56,010,104 (GRCm39) probably benign Het
Anpep T G 7: 79,489,047 (GRCm39) D347A probably damaging Het
Arhgap28 C T 17: 68,203,159 (GRCm39) probably null Het
Ccdc32 A G 2: 118,857,610 (GRCm39) probably benign Het
Cdc42bpa A G 1: 179,972,400 (GRCm39) T1401A possibly damaging Het
Celsr2 A G 3: 108,319,939 (GRCm39) Y958H probably damaging Het
Cenpe A G 3: 134,923,066 (GRCm39) E137G probably damaging Het
Chd8 T C 14: 52,450,890 (GRCm39) D1399G probably damaging Het
Col10a1 A G 10: 34,271,692 (GRCm39) T555A possibly damaging Het
Crybg3 A C 16: 59,385,574 (GRCm39) probably null Het
Cts7 A G 13: 61,503,548 (GRCm39) F139L probably damaging Het
Dera T C 6: 137,773,745 (GRCm39) probably benign Het
Dgka A G 10: 128,559,129 (GRCm39) probably benign Het
Dhrs7 T A 12: 72,699,125 (GRCm39) I286F probably damaging Het
Dtwd2 A G 18: 49,861,424 (GRCm39) probably benign Het
Fermt1 A G 2: 132,748,653 (GRCm39) S657P probably damaging Het
Fhip2b T C 14: 70,825,727 (GRCm39) D351G probably damaging Het
Flnb T C 14: 7,890,810 (GRCm38) V564A probably benign Het
Garnl3 A G 2: 32,975,919 (GRCm39) F16L probably damaging Het
Gck T C 11: 5,856,691 (GRCm39) R191G probably damaging Het
Gucy1b1 A T 3: 81,952,941 (GRCm39) probably benign Het
Ifna2 A C 4: 88,601,895 (GRCm39) L41R probably damaging Het
Krt33a T G 11: 99,903,541 (GRCm39) E197A probably damaging Het
Lce1e G A 3: 92,615,063 (GRCm39) R95C unknown Het
Lct G T 1: 128,235,971 (GRCm39) S345R probably benign Het
Lrp2 A T 2: 69,281,724 (GRCm39) N3882K probably benign Het
Mcc G T 18: 44,578,927 (GRCm39) T652K possibly damaging Het
Mier1 A G 4: 102,996,699 (GRCm39) S109G probably benign Het
Nfat5 A G 8: 108,082,237 (GRCm39) N469S probably damaging Het
Or1e23 C A 11: 73,407,670 (GRCm39) M118I possibly damaging Het
Or6c214 G A 10: 129,591,271 (GRCm39) T16I probably damaging Het
Piwil1 G T 5: 128,820,371 (GRCm39) R256M probably null Het
Rgma T C 7: 73,059,160 (GRCm39) V88A probably damaging Het
Sdk2 T C 11: 113,685,746 (GRCm39) probably null Het
Sec22b A G 3: 97,819,990 (GRCm39) E94G probably damaging Het
Snrnp70 T C 7: 45,036,669 (GRCm39) R131G possibly damaging Het
Spata31d1a A G 13: 59,848,199 (GRCm39) S1310P possibly damaging Het
Spint1 A G 2: 119,076,948 (GRCm39) E344G probably damaging Het
Srrm1 G A 4: 135,052,302 (GRCm39) Q141* probably null Het
Tecta A T 9: 42,295,637 (GRCm39) L286Q probably damaging Het
Tep1 T A 14: 51,104,301 (GRCm39) K198* probably null Het
Tk2 A G 8: 104,957,824 (GRCm39) V174A probably benign Het
Txndc5 T C 13: 38,691,872 (GRCm39) K165E probably damaging Het
Ubr4 G A 4: 139,151,217 (GRCm39) R1884Q probably damaging Het
Vmn2r61 T C 7: 41,949,844 (GRCm39) Y755H probably damaging Het
Xrn1 T A 9: 95,855,592 (GRCm39) H296Q probably damaging Het
Zar1l A T 5: 150,436,407 (GRCm39) V223D probably damaging Het
Other mutations in Cntn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Cntn3 APN 6 102,397,223 (GRCm39) nonsense probably null
IGL00706:Cntn3 APN 6 102,180,910 (GRCm39) missense probably benign 0.11
IGL01071:Cntn3 APN 6 102,397,212 (GRCm39) critical splice donor site probably null
IGL01769:Cntn3 APN 6 102,185,145 (GRCm39) missense probably damaging 1.00
IGL01995:Cntn3 APN 6 102,180,846 (GRCm39) missense probably damaging 1.00
IGL02058:Cntn3 APN 6 102,176,321 (GRCm39) splice site probably benign
IGL02736:Cntn3 APN 6 102,180,900 (GRCm39) missense probably damaging 1.00
IGL02955:Cntn3 APN 6 102,255,262 (GRCm39) missense probably damaging 1.00
IGL02971:Cntn3 APN 6 102,145,894 (GRCm39) missense probably damaging 1.00
IGL03208:Cntn3 APN 6 102,164,060 (GRCm39) missense probably damaging 0.99
P0037:Cntn3 UTSW 6 102,186,235 (GRCm39) missense probably damaging 1.00
PIT4431001:Cntn3 UTSW 6 102,441,527 (GRCm39) missense probably benign 0.22
R0314:Cntn3 UTSW 6 102,397,342 (GRCm39) missense probably damaging 1.00
R0388:Cntn3 UTSW 6 102,254,277 (GRCm39) missense probably damaging 0.96
R0483:Cntn3 UTSW 6 102,180,927 (GRCm39) missense probably damaging 1.00
R0539:Cntn3 UTSW 6 102,254,178 (GRCm39) critical splice donor site probably null
R0543:Cntn3 UTSW 6 102,246,051 (GRCm39) splice site probably benign
R0629:Cntn3 UTSW 6 102,180,937 (GRCm39) missense probably damaging 1.00
R0693:Cntn3 UTSW 6 102,145,908 (GRCm39) missense possibly damaging 0.48
R0781:Cntn3 UTSW 6 102,222,119 (GRCm39) missense probably benign 0.22
R1110:Cntn3 UTSW 6 102,222,119 (GRCm39) missense probably benign 0.22
R1144:Cntn3 UTSW 6 102,219,087 (GRCm39) missense possibly damaging 0.65
R1503:Cntn3 UTSW 6 102,441,526 (GRCm39) nonsense probably null
R1640:Cntn3 UTSW 6 102,218,974 (GRCm39) missense possibly damaging 0.82
R1681:Cntn3 UTSW 6 102,147,629 (GRCm39) missense probably damaging 1.00
R1770:Cntn3 UTSW 6 102,246,166 (GRCm39) missense possibly damaging 0.49
R1782:Cntn3 UTSW 6 102,250,772 (GRCm39) missense probably damaging 0.97
R1861:Cntn3 UTSW 6 102,222,032 (GRCm39) missense probably benign 0.11
R1930:Cntn3 UTSW 6 102,219,014 (GRCm39) nonsense probably null
R2026:Cntn3 UTSW 6 102,397,388 (GRCm39) missense probably damaging 1.00
R2152:Cntn3 UTSW 6 102,183,498 (GRCm39) missense probably damaging 1.00
R2313:Cntn3 UTSW 6 102,180,889 (GRCm39) missense probably benign
R2351:Cntn3 UTSW 6 102,314,344 (GRCm39) missense possibly damaging 0.55
R3611:Cntn3 UTSW 6 102,185,038 (GRCm39) missense possibly damaging 0.77
R4349:Cntn3 UTSW 6 102,176,312 (GRCm39) missense probably damaging 1.00
R4421:Cntn3 UTSW 6 102,441,508 (GRCm39) missense probably damaging 0.97
R4513:Cntn3 UTSW 6 102,145,943 (GRCm39) missense probably benign 0.37
R4678:Cntn3 UTSW 6 102,180,981 (GRCm39) missense probably damaging 1.00
R4702:Cntn3 UTSW 6 102,142,292 (GRCm39) missense probably benign 0.37
R4720:Cntn3 UTSW 6 102,218,983 (GRCm39) missense possibly damaging 0.65
R4879:Cntn3 UTSW 6 102,244,389 (GRCm39) missense possibly damaging 0.47
R4951:Cntn3 UTSW 6 102,145,986 (GRCm39) missense possibly damaging 0.90
R5410:Cntn3 UTSW 6 102,255,314 (GRCm39) missense probably benign 0.01
R5502:Cntn3 UTSW 6 102,242,295 (GRCm39) missense possibly damaging 0.58
R5852:Cntn3 UTSW 6 102,397,377 (GRCm39) missense probably damaging 1.00
R5903:Cntn3 UTSW 6 102,219,094 (GRCm39) missense probably benign 0.00
R6193:Cntn3 UTSW 6 102,185,092 (GRCm39) missense probably benign 0.31
R6258:Cntn3 UTSW 6 102,254,178 (GRCm39) critical splice donor site probably null
R6260:Cntn3 UTSW 6 102,254,178 (GRCm39) critical splice donor site probably null
R6350:Cntn3 UTSW 6 102,147,579 (GRCm39) missense probably damaging 1.00
R6490:Cntn3 UTSW 6 102,255,301 (GRCm39) missense probably damaging 0.99
R6993:Cntn3 UTSW 6 102,255,365 (GRCm39) missense probably damaging 0.98
R7064:Cntn3 UTSW 6 102,250,772 (GRCm39) missense probably damaging 0.97
R7085:Cntn3 UTSW 6 102,142,362 (GRCm39) missense possibly damaging 0.85
R7174:Cntn3 UTSW 6 102,142,305 (GRCm39) missense probably benign
R7208:Cntn3 UTSW 6 102,255,383 (GRCm39) nonsense probably null
R7395:Cntn3 UTSW 6 102,314,355 (GRCm39) critical splice acceptor site probably null
R7447:Cntn3 UTSW 6 102,255,416 (GRCm39) nonsense probably null
R7571:Cntn3 UTSW 6 102,255,364 (GRCm39) missense probably damaging 1.00
R7586:Cntn3 UTSW 6 102,397,388 (GRCm39) missense probably damaging 1.00
R7614:Cntn3 UTSW 6 102,142,337 (GRCm39) missense probably benign 0.17
R7697:Cntn3 UTSW 6 102,185,128 (GRCm39) missense probably damaging 1.00
R7697:Cntn3 UTSW 6 102,185,127 (GRCm39) missense probably damaging 1.00
R7849:Cntn3 UTSW 6 102,242,392 (GRCm39) missense probably benign 0.00
R8011:Cntn3 UTSW 6 102,414,860 (GRCm39) missense possibly damaging 0.93
R8013:Cntn3 UTSW 6 102,176,278 (GRCm39) missense probably benign 0.00
R8377:Cntn3 UTSW 6 102,186,254 (GRCm39) missense probably benign 0.00
R8726:Cntn3 UTSW 6 102,146,014 (GRCm39) nonsense probably null
R8770:Cntn3 UTSW 6 102,254,277 (GRCm39) missense possibly damaging 0.67
R8827:Cntn3 UTSW 6 102,246,094 (GRCm39) missense probably benign 0.01
R8947:Cntn3 UTSW 6 102,414,864 (GRCm39) missense probably damaging 1.00
R8997:Cntn3 UTSW 6 102,181,023 (GRCm39) missense probably damaging 0.98
R9055:Cntn3 UTSW 6 102,244,398 (GRCm39) missense probably benign 0.38
R9061:Cntn3 UTSW 6 102,314,288 (GRCm39) missense probably damaging 1.00
R9758:Cntn3 UTSW 6 102,183,511 (GRCm39) missense probably damaging 1.00
R9762:Cntn3 UTSW 6 102,254,196 (GRCm39) missense probably damaging 1.00
Z1088:Cntn3 UTSW 6 102,397,255 (GRCm39) missense possibly damaging 0.74
Z1176:Cntn3 UTSW 6 102,414,892 (GRCm39) critical splice acceptor site probably null
Z1177:Cntn3 UTSW 6 102,314,292 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GGAAAATGGACAGGCAGCATACCCATC -3'
(R):5'- ACCCAGCTTCCTCAGTTTTGAGAACC -3'

Sequencing Primer
(F):5'- TGAGCTCAACCGACTTACTG -3'
(R):5'- CCTCAGTTTTGAGAACCCAATGG -3'
Posted On 2014-09-10