Incidental Mutation 'R0691:Rgma'
ID226039
Institutional Source Beutler Lab
Gene Symbol Rgma
Ensembl Gene ENSMUSG00000070509
Gene Namerepulsive guidance molecule family member A
SynonymsRGM domain family, member A
MMRRC Submission 038876-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R0691 (G1)
Quality Score50
Status Validated
Chromosome7
Chromosomal Location73375509-73419899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73409412 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 88 (V88A)
Ref Sequence ENSEMBL: ENSMUSP00000145758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094312] [ENSMUST00000119206] [ENSMUST00000128471] [ENSMUST00000139780]
Predicted Effect probably damaging
Transcript: ENSMUST00000094312
AA Change: V104A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091870
Gene: ENSMUSG00000070509
AA Change: V104A

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:RGM_N 48 223 6.6e-74 PFAM
Pfam:RGM_C 227 410 1.5e-75 PFAM
low complexity region 422 430 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119206
SMART Domains Protein: ENSMUSP00000112599
Gene: ENSMUSG00000070509

DomainStartEndE-ValueType
Pfam:RGM_N 1 113 3.8e-45 PFAM
Pfam:RGM_C 117 302 1.8e-76 PFAM
low complexity region 312 320 N/A INTRINSIC
low complexity region 329 343 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128471
AA Change: V88A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116552
Gene: ENSMUSG00000070509
AA Change: V88A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:RGM_N 32 101 7.5e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139780
AA Change: V88A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206096
Meta Mutation Damage Score 0.7236 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the repulsive guidance molecule family. The encoded protein is a glycosylphosphatidylinositol-anchored glycoprotein that functions as an axon guidance protein in the developing and adult central nervous system. This protein may also function as a tumor suppressor in some cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Inactivation of this locus results in impaired cephalic closure and subsequent exencephaly, both with incomplete penetrance. The retinal topography of the visual system is normal in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,639,253 D865G possibly damaging Het
Acy1 A T 9: 106,435,871 probably null Het
Adcy4 A T 14: 55,772,647 probably benign Het
Anpep T G 7: 79,839,299 D347A probably damaging Het
Arhgap28 C T 17: 67,896,164 probably null Het
Ccdc32 A G 2: 119,027,129 probably benign Het
Cdc42bpa A G 1: 180,144,835 T1401A possibly damaging Het
Celsr2 A G 3: 108,412,623 Y958H probably damaging Het
Cenpe A G 3: 135,217,305 E137G probably damaging Het
Chd8 T C 14: 52,213,433 D1399G probably damaging Het
Cntn3 T C 6: 102,168,947 T978A possibly damaging Het
Col10a1 A G 10: 34,395,696 T555A possibly damaging Het
Crybg3 A C 16: 59,565,211 probably null Het
Cts7 A G 13: 61,355,734 F139L probably damaging Het
Dera T C 6: 137,796,747 probably benign Het
Dgka A G 10: 128,723,260 probably benign Het
Dhrs7 T A 12: 72,652,351 I286F probably damaging Het
Dtwd2 A G 18: 49,728,357 probably benign Het
Fam160b2 T C 14: 70,588,287 D351G probably damaging Het
Fermt1 A G 2: 132,906,733 S657P probably damaging Het
Flnb T C 14: 7,890,810 V564A probably benign Het
Garnl3 A G 2: 33,085,907 F16L probably damaging Het
Gck T C 11: 5,906,691 R191G probably damaging Het
Gucy1b1 A T 3: 82,045,634 probably benign Het
Ifna2 A C 4: 88,683,658 L41R probably damaging Het
Krt33a T G 11: 100,012,715 E197A probably damaging Het
Lce1e G A 3: 92,707,756 R95C unknown Het
Lct G T 1: 128,308,234 S345R probably benign Het
Lrp2 A T 2: 69,451,380 N3882K probably benign Het
Mcc G T 18: 44,445,860 T652K possibly damaging Het
Mier1 A G 4: 103,139,502 S109G probably benign Het
Nfat5 A G 8: 107,355,605 N469S probably damaging Het
Olfr382 C A 11: 73,516,844 M118I possibly damaging Het
Olfr807 G A 10: 129,755,402 T16I probably damaging Het
Piwil1 G T 5: 128,743,307 R256M probably null Het
Sdk2 T C 11: 113,794,920 probably null Het
Sec22b A G 3: 97,912,674 E94G probably damaging Het
Snrnp70 T C 7: 45,387,245 R131G possibly damaging Het
Spata31d1a A G 13: 59,700,385 S1310P possibly damaging Het
Spint1 A G 2: 119,246,467 E344G probably damaging Het
Srrm1 G A 4: 135,324,991 Q141* probably null Het
Tecta A T 9: 42,384,341 L286Q probably damaging Het
Tep1 T A 14: 50,866,844 K198* probably null Het
Tk2 A G 8: 104,231,192 V174A probably benign Het
Txndc5 T C 13: 38,507,896 K165E probably damaging Het
Ubr4 G A 4: 139,423,906 R1884Q probably damaging Het
Vmn2r61 T C 7: 42,300,420 Y755H probably damaging Het
Xrn1 T A 9: 95,973,539 H296Q probably damaging Het
Zar1l A T 5: 150,512,942 V223D probably damaging Het
Other mutations in Rgma
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Rgma APN 7 73417491 missense probably damaging 1.00
IGL01089:Rgma APN 7 73409714 missense possibly damaging 0.79
IGL01336:Rgma APN 7 73409318 missense possibly damaging 0.61
IGL01339:Rgma APN 7 73417483 missense probably damaging 1.00
IGL01340:Rgma APN 7 73417330 missense probably damaging 1.00
IGL02034:Rgma APN 7 73417433 missense probably damaging 0.99
IGL03003:Rgma APN 7 73417440 missense probably damaging 0.97
IGL03050:Rgma UTSW 7 73417515 missense probably damaging 1.00
R0173:Rgma UTSW 7 73417554 missense probably damaging 1.00
R0630:Rgma UTSW 7 73417618 missense probably damaging 1.00
R0696:Rgma UTSW 7 73409412 missense probably damaging 0.99
R0971:Rgma UTSW 7 73391498 critical splice donor site probably null
R1394:Rgma UTSW 7 73417794 missense probably benign 0.06
R1395:Rgma UTSW 7 73417794 missense probably benign 0.06
R1707:Rgma UTSW 7 73417959 missense unknown
R1731:Rgma UTSW 7 73409412 missense probably damaging 0.99
R1792:Rgma UTSW 7 73417837 missense probably damaging 0.97
R2068:Rgma UTSW 7 73409631 missense probably damaging 0.98
R2327:Rgma UTSW 7 73417826 missense probably damaging 1.00
R4707:Rgma UTSW 7 73417816 missense probably damaging 1.00
R5976:Rgma UTSW 7 73409468 missense probably damaging 0.97
R6458:Rgma UTSW 7 73409694 missense probably damaging 1.00
R6702:Rgma UTSW 7 73417320 missense probably damaging 1.00
R7123:Rgma UTSW 7 73409391 missense probably damaging 1.00
R7767:Rgma UTSW 7 73418004 missense unknown
V7732:Rgma UTSW 7 73417320 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAAGTGCAACTCTGAGTTCTGG -3'
(R):5'- TTCTTCACTGACCACAGTGGTGC -3'

Sequencing Primer
(F):5'- GAGCGCCACGTCATCAG -3'
(R):5'- GCACCTTGCATGTCTGGAAG -3'
Posted On2014-09-10