Incidental Mutation 'R0691:Nfat5'
ID 226040
Institutional Source Beutler Lab
Gene Symbol Nfat5
Ensembl Gene ENSMUSG00000003847
Gene Name nuclear factor of activated T cells 5
Synonyms OREBP, B130038B15Rik, nfatz, TonEBP
MMRRC Submission 038876-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.910) question?
Stock # R0691 (G1)
Quality Score 59
Status Validated
Chromosome 8
Chromosomal Location 108020102-108106149 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108082237 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 469 (N469S)
Ref Sequence ENSEMBL: ENSMUSP00000116094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075922] [ENSMUST00000077440] [ENSMUST00000125721] [ENSMUST00000133026] [ENSMUST00000151114] [ENSMUST00000169453] [ENSMUST00000154474] [ENSMUST00000147588] [ENSMUST00000144100]
AlphaFold Q9WV30
Predicted Effect probably damaging
Transcript: ENSMUST00000075922
AA Change: N469S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075311
Gene: ENSMUSG00000003847
AA Change: N469S

DomainStartEndE-ValueType
low complexity region 52 98 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
Pfam:RHD 282 439 7.8e-23 PFAM
IPT 444 542 3.33e-15 SMART
low complexity region 647 653 N/A INTRINSIC
low complexity region 734 754 N/A INTRINSIC
low complexity region 793 810 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 915 920 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077440
AA Change: N393S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076653
Gene: ENSMUSG00000003847
AA Change: N393S

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 103 116 N/A INTRINSIC
Pfam:RHD 206 363 1.5e-22 PFAM
IPT 368 466 3.33e-15 SMART
low complexity region 571 577 N/A INTRINSIC
low complexity region 658 678 N/A INTRINSIC
low complexity region 717 734 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 839 844 N/A INTRINSIC
low complexity region 887 901 N/A INTRINSIC
internal_repeat_2 927 1110 7.13e-8 PROSPERO
internal_repeat_1 935 1128 2.59e-11 PROSPERO
internal_repeat_2 1122 1324 7.13e-8 PROSPERO
internal_repeat_1 1207 1426 2.59e-11 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000125721
AA Change: N469S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116094
Gene: ENSMUSG00000003847
AA Change: N469S

DomainStartEndE-ValueType
low complexity region 52 98 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
Pfam:RHD 282 439 1e-22 PFAM
IPT 444 542 3.33e-15 SMART
low complexity region 647 653 N/A INTRINSIC
low complexity region 734 754 N/A INTRINSIC
low complexity region 793 810 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 915 920 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
internal_repeat_2 1003 1186 2.22e-8 PROSPERO
internal_repeat_1 1011 1204 5.31e-12 PROSPERO
internal_repeat_2 1198 1400 2.22e-8 PROSPERO
internal_repeat_1 1283 1502 5.31e-12 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000126333
SMART Domains Protein: ENSMUSP00000118130
Gene: ENSMUSG00000003847

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 30 132 6.8e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126397
Predicted Effect probably benign
Transcript: ENSMUST00000133026
SMART Domains Protein: ENSMUSP00000116631
Gene: ENSMUSG00000003847

DomainStartEndE-ValueType
low complexity region 70 88 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151114
AA Change: N487S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119370
Gene: ENSMUSG00000003847
AA Change: N487S

DomainStartEndE-ValueType
low complexity region 70 116 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
Pfam:RHD_DNA_bind 300 457 1.1e-22 PFAM
IPT 462 560 3.33e-15 SMART
low complexity region 665 671 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 811 828 N/A INTRINSIC
low complexity region 916 928 N/A INTRINSIC
low complexity region 933 938 N/A INTRINSIC
low complexity region 981 995 N/A INTRINSIC
internal_repeat_2 1021 1204 2.24e-8 PROSPERO
internal_repeat_1 1029 1222 5.32e-12 PROSPERO
internal_repeat_2 1216 1418 2.24e-8 PROSPERO
internal_repeat_1 1301 1520 5.32e-12 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000169453
AA Change: N487S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127784
Gene: ENSMUSG00000003847
AA Change: N487S

DomainStartEndE-ValueType
low complexity region 70 116 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
Pfam:RHD_DNA_bind 300 457 1.1e-22 PFAM
IPT 462 560 3.33e-15 SMART
low complexity region 665 671 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 811 828 N/A INTRINSIC
low complexity region 916 928 N/A INTRINSIC
low complexity region 933 938 N/A INTRINSIC
low complexity region 981 995 N/A INTRINSIC
internal_repeat_2 1021 1204 2.24e-8 PROSPERO
internal_repeat_1 1029 1222 5.32e-12 PROSPERO
internal_repeat_2 1216 1418 2.24e-8 PROSPERO
internal_repeat_1 1301 1520 5.32e-12 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148006
Predicted Effect probably benign
Transcript: ENSMUST00000154474
SMART Domains Protein: ENSMUSP00000115036
Gene: ENSMUSG00000003847

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147588
SMART Domains Protein: ENSMUSP00000122871
Gene: ENSMUSG00000003847

DomainStartEndE-ValueType
Blast:IPT 1 42 3e-20 BLAST
PDB:1IMH|D 1 44 2e-20 PDB
SCOP:d1bfta_ 1 44 3e-14 SMART
low complexity region 146 152 N/A INTRINSIC
low complexity region 233 253 N/A INTRINSIC
low complexity region 292 309 N/A INTRINSIC
low complexity region 397 409 N/A INTRINSIC
low complexity region 414 419 N/A INTRINSIC
low complexity region 462 476 N/A INTRINSIC
internal_repeat_2 502 685 1.17e-6 PROSPERO
internal_repeat_1 510 703 1.39e-9 PROSPERO
internal_repeat_2 697 899 1.17e-6 PROSPERO
internal_repeat_1 782 1001 1.39e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000144100
Meta Mutation Damage Score 0.3973 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells family of transcription factors. Proteins belonging to this family play a central role in inducible gene transcription during the immune response. This protein regulates gene expression induced by osmotic stress in mammalian cells. Unlike monomeric members of this protein family, this protein exists as a homodimer and forms stable dimers with DNA elements. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one of several knock-out allele exhibit lethality between E14.5 and E17.5 as well as around P10 with kidney, cardiac or immune defects depending on the allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,584,979 (GRCm39) D865G possibly damaging Het
Acy1 A T 9: 106,313,070 (GRCm39) probably null Het
Adcy4 A T 14: 56,010,104 (GRCm39) probably benign Het
Anpep T G 7: 79,489,047 (GRCm39) D347A probably damaging Het
Arhgap28 C T 17: 68,203,159 (GRCm39) probably null Het
Ccdc32 A G 2: 118,857,610 (GRCm39) probably benign Het
Cdc42bpa A G 1: 179,972,400 (GRCm39) T1401A possibly damaging Het
Celsr2 A G 3: 108,319,939 (GRCm39) Y958H probably damaging Het
Cenpe A G 3: 134,923,066 (GRCm39) E137G probably damaging Het
Chd8 T C 14: 52,450,890 (GRCm39) D1399G probably damaging Het
Cntn3 T C 6: 102,145,908 (GRCm39) T978A possibly damaging Het
Col10a1 A G 10: 34,271,692 (GRCm39) T555A possibly damaging Het
Crybg3 A C 16: 59,385,574 (GRCm39) probably null Het
Cts7 A G 13: 61,503,548 (GRCm39) F139L probably damaging Het
Dera T C 6: 137,773,745 (GRCm39) probably benign Het
Dgka A G 10: 128,559,129 (GRCm39) probably benign Het
Dhrs7 T A 12: 72,699,125 (GRCm39) I286F probably damaging Het
Dtwd2 A G 18: 49,861,424 (GRCm39) probably benign Het
Fermt1 A G 2: 132,748,653 (GRCm39) S657P probably damaging Het
Fhip2b T C 14: 70,825,727 (GRCm39) D351G probably damaging Het
Flnb T C 14: 7,890,810 (GRCm38) V564A probably benign Het
Garnl3 A G 2: 32,975,919 (GRCm39) F16L probably damaging Het
Gck T C 11: 5,856,691 (GRCm39) R191G probably damaging Het
Gucy1b1 A T 3: 81,952,941 (GRCm39) probably benign Het
Ifna2 A C 4: 88,601,895 (GRCm39) L41R probably damaging Het
Krt33a T G 11: 99,903,541 (GRCm39) E197A probably damaging Het
Lce1e G A 3: 92,615,063 (GRCm39) R95C unknown Het
Lct G T 1: 128,235,971 (GRCm39) S345R probably benign Het
Lrp2 A T 2: 69,281,724 (GRCm39) N3882K probably benign Het
Mcc G T 18: 44,578,927 (GRCm39) T652K possibly damaging Het
Mier1 A G 4: 102,996,699 (GRCm39) S109G probably benign Het
Or1e23 C A 11: 73,407,670 (GRCm39) M118I possibly damaging Het
Or6c214 G A 10: 129,591,271 (GRCm39) T16I probably damaging Het
Piwil1 G T 5: 128,820,371 (GRCm39) R256M probably null Het
Rgma T C 7: 73,059,160 (GRCm39) V88A probably damaging Het
Sdk2 T C 11: 113,685,746 (GRCm39) probably null Het
Sec22b A G 3: 97,819,990 (GRCm39) E94G probably damaging Het
Snrnp70 T C 7: 45,036,669 (GRCm39) R131G possibly damaging Het
Spata31d1a A G 13: 59,848,199 (GRCm39) S1310P possibly damaging Het
Spint1 A G 2: 119,076,948 (GRCm39) E344G probably damaging Het
Srrm1 G A 4: 135,052,302 (GRCm39) Q141* probably null Het
Tecta A T 9: 42,295,637 (GRCm39) L286Q probably damaging Het
Tep1 T A 14: 51,104,301 (GRCm39) K198* probably null Het
Tk2 A G 8: 104,957,824 (GRCm39) V174A probably benign Het
Txndc5 T C 13: 38,691,872 (GRCm39) K165E probably damaging Het
Ubr4 G A 4: 139,151,217 (GRCm39) R1884Q probably damaging Het
Vmn2r61 T C 7: 41,949,844 (GRCm39) Y755H probably damaging Het
Xrn1 T A 9: 95,855,592 (GRCm39) H296Q probably damaging Het
Zar1l A T 5: 150,436,407 (GRCm39) V223D probably damaging Het
Other mutations in Nfat5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Nfat5 APN 8 108,094,146 (GRCm39) missense probably damaging 1.00
IGL01145:Nfat5 APN 8 108,093,847 (GRCm39) missense probably damaging 0.99
IGL01700:Nfat5 APN 8 108,065,762 (GRCm39) missense probably damaging 0.99
IGL01721:Nfat5 APN 8 108,071,611 (GRCm39) critical splice donor site probably null
IGL01796:Nfat5 APN 8 108,094,273 (GRCm39) missense probably damaging 1.00
IGL01976:Nfat5 APN 8 108,094,191 (GRCm39) missense probably damaging 1.00
IGL02063:Nfat5 APN 8 108,088,450 (GRCm39) missense probably benign 0.03
IGL02150:Nfat5 APN 8 108,094,584 (GRCm39) nonsense probably null
IGL02174:Nfat5 APN 8 108,065,683 (GRCm39) missense probably damaging 1.00
IGL02224:Nfat5 APN 8 108,071,447 (GRCm39) missense probably benign 0.00
IGL02226:Nfat5 APN 8 108,078,154 (GRCm39) nonsense probably null
IGL02324:Nfat5 APN 8 108,092,808 (GRCm39) splice site probably benign
IGL02724:Nfat5 APN 8 108,085,367 (GRCm39) missense probably damaging 0.97
fettfeld UTSW 8 108,074,359 (GRCm39) missense probably damaging 1.00
Grunefeld UTSW 8 108,082,140 (GRCm39) splice site probably null
Kleinfeld UTSW 8 108,078,070 (GRCm39) missense probably damaging 1.00
Lisa UTSW 8 108,074,321 (GRCm39) missense probably damaging 1.00
viola UTSW 8 108,085,300 (GRCm39) missense probably damaging 1.00
H8562:Nfat5 UTSW 8 108,066,014 (GRCm39) splice site probably benign
R0003:Nfat5 UTSW 8 108,065,707 (GRCm39) missense probably damaging 1.00
R0117:Nfat5 UTSW 8 108,065,707 (GRCm39) missense probably damaging 1.00
R0118:Nfat5 UTSW 8 108,065,707 (GRCm39) missense probably damaging 1.00
R0119:Nfat5 UTSW 8 108,065,707 (GRCm39) missense probably damaging 1.00
R0135:Nfat5 UTSW 8 108,065,707 (GRCm39) missense probably damaging 1.00
R0138:Nfat5 UTSW 8 108,065,707 (GRCm39) missense probably damaging 1.00
R0141:Nfat5 UTSW 8 108,065,707 (GRCm39) missense probably damaging 1.00
R0302:Nfat5 UTSW 8 108,085,333 (GRCm39) missense probably damaging 1.00
R0420:Nfat5 UTSW 8 108,094,093 (GRCm39) missense probably damaging 1.00
R0613:Nfat5 UTSW 8 108,092,927 (GRCm39) missense possibly damaging 0.83
R0743:Nfat5 UTSW 8 108,094,698 (GRCm39) missense probably damaging 1.00
R1329:Nfat5 UTSW 8 108,095,659 (GRCm39) missense probably benign 0.42
R1550:Nfat5 UTSW 8 108,097,205 (GRCm39) missense probably damaging 0.99
R1590:Nfat5 UTSW 8 108,020,522 (GRCm39) missense probably damaging 1.00
R1778:Nfat5 UTSW 8 108,088,421 (GRCm39) missense probably damaging 1.00
R1827:Nfat5 UTSW 8 108,093,966 (GRCm39) missense probably benign 0.00
R1918:Nfat5 UTSW 8 108,092,868 (GRCm39) missense probably damaging 0.97
R2679:Nfat5 UTSW 8 108,071,546 (GRCm39) missense probably damaging 1.00
R2850:Nfat5 UTSW 8 108,020,492 (GRCm39) missense probably damaging 1.00
R3703:Nfat5 UTSW 8 108,078,053 (GRCm39) splice site probably benign
R3966:Nfat5 UTSW 8 108,093,921 (GRCm39) missense possibly damaging 0.47
R4301:Nfat5 UTSW 8 108,082,327 (GRCm39) intron probably benign
R4596:Nfat5 UTSW 8 108,078,132 (GRCm39) missense possibly damaging 0.93
R4602:Nfat5 UTSW 8 108,093,855 (GRCm39) nonsense probably null
R4627:Nfat5 UTSW 8 108,095,908 (GRCm39) missense probably damaging 1.00
R4917:Nfat5 UTSW 8 108,051,284 (GRCm39) missense probably damaging 1.00
R4918:Nfat5 UTSW 8 108,051,284 (GRCm39) missense probably damaging 1.00
R5089:Nfat5 UTSW 8 108,078,070 (GRCm39) missense probably damaging 1.00
R5495:Nfat5 UTSW 8 108,095,079 (GRCm39) missense probably benign 0.03
R5566:Nfat5 UTSW 8 108,095,767 (GRCm39) missense possibly damaging 0.47
R5851:Nfat5 UTSW 8 108,074,359 (GRCm39) missense probably damaging 1.00
R6012:Nfat5 UTSW 8 108,093,765 (GRCm39) missense probably benign 0.09
R6018:Nfat5 UTSW 8 108,082,283 (GRCm39) critical splice donor site probably null
R6364:Nfat5 UTSW 8 108,094,909 (GRCm39) missense probably benign 0.00
R6404:Nfat5 UTSW 8 108,097,220 (GRCm39) missense probably benign 0.01
R6466:Nfat5 UTSW 8 108,082,140 (GRCm39) splice site probably null
R7056:Nfat5 UTSW 8 108,094,738 (GRCm39) missense probably damaging 1.00
R7105:Nfat5 UTSW 8 108,095,823 (GRCm39) missense possibly damaging 0.88
R7128:Nfat5 UTSW 8 108,085,323 (GRCm39) missense probably benign 0.10
R7214:Nfat5 UTSW 8 108,020,515 (GRCm39) missense probably damaging 0.99
R7276:Nfat5 UTSW 8 108,093,731 (GRCm39) missense probably benign 0.25
R7560:Nfat5 UTSW 8 108,097,221 (GRCm39) missense probably benign 0.15
R7844:Nfat5 UTSW 8 108,085,300 (GRCm39) missense probably damaging 1.00
R7993:Nfat5 UTSW 8 108,082,134 (GRCm39) splice site probably null
R8407:Nfat5 UTSW 8 108,094,047 (GRCm39) nonsense probably null
R8428:Nfat5 UTSW 8 108,095,152 (GRCm39) missense probably damaging 0.96
R8798:Nfat5 UTSW 8 108,074,321 (GRCm39) missense probably damaging 1.00
R8919:Nfat5 UTSW 8 108,095,228 (GRCm39) missense probably damaging 0.99
R9067:Nfat5 UTSW 8 108,094,536 (GRCm39) missense probably benign 0.07
R9123:Nfat5 UTSW 8 108,078,141 (GRCm39) missense probably damaging 0.97
R9226:Nfat5 UTSW 8 108,095,401 (GRCm39) missense probably damaging 1.00
R9351:Nfat5 UTSW 8 108,065,910 (GRCm39) missense probably damaging 1.00
X0022:Nfat5 UTSW 8 108,074,388 (GRCm39) nonsense probably null
Z1177:Nfat5 UTSW 8 108,065,474 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- acatacacaGAGAGACAGGTGGTCC -3'
(R):5'- CCTTCTGCGAGCATCTTCACAAGC -3'

Sequencing Primer
(F):5'- TGTATCCACAGCTCAGCCAG -3'
(R):5'- gtcagaactggaaggaacctc -3'
Posted On 2014-09-10