Mutagenetix > Incidental Mutations

Incidental Mutation 'R0691:Tecta'

226041

Institutional Source

Beutler Lab

Gene Symbol

Tecta

Ensembl Gene

ENSMUSG00000037705

Gene Name

tectorin alpha

Synonyms

[a]-tectorin, Tctna

MMRRC Submission

038876-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R0691 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

42329619-42399929 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 42384341 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 286 (L286Q)

Ref Sequence

ENSEMBL: ENSMUSP00000125370 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]

Predicted Effect

probably damaging
Transcript: ENSMUST00000042190
AA Change: L286Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: L286Q

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
NIDO	98	254	7.88e-77	SMART
VWC	260	314	1.04e0	SMART
VWD	312	477	1.5e-58	SMART
C8	517	592	7.06e-29	SMART
EGF_like	622	645	3.87e1	SMART
VWC	652	713	1.87e-1	SMART
VWD	703	865	4.44e-43	SMART
C8	905	981	9.19e-19	SMART
Pfam:TIL	984	1036	9.8e-13	PFAM
VWD	1090	1257	1.44e-51	SMART
C8	1294	1369	4.64e-15	SMART
EGF_like	1388	1420	5.34e1	SMART
VWC	1427	1487	2.88e-19	SMART
VWD	1477	1638	2.72e-38	SMART
C8	1684	1758	6.51e-10	SMART
ZP	1805	2059	2.95e-85	SMART
EGF	2087	2122	2.07e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160940
AA Change: L286Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: L286Q

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
NIDO	98	254	7.88e-77	SMART
VWC	260	314	1.04e0	SMART
VWD	312	477	1.5e-58	SMART
C8	517	592	7.06e-29	SMART
EGF_like	622	645	3.87e1	SMART
VWC	652	713	1.87e-1	SMART
VWD	703	865	4.44e-43	SMART
C8	905	981	9.19e-19	SMART
Pfam:TIL	984	1036	6.1e-13	PFAM
VWD	1090	1257	1.44e-51	SMART
C8	1294	1369	4.64e-15	SMART
EGF_like	1388	1420	5.34e1	SMART
VWC	1427	1487	2.88e-19	SMART
VWD	1477	1638	2.72e-38	SMART
C8	1679	1753	6.51e-10	SMART
ZP	1800	2054	2.95e-85	SMART
EGF	2082	2117	2.07e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215213

Meta Mutation Damage Score

0.1159

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.4%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	T	C	6: 142,639,253	D865G	possibly damaging	Het
Acy1	A	T	9: 106,435,871		probably null	Het
Adcy4	A	T	14: 55,772,647		probably benign	Het
Anpep	T	G	7: 79,839,299	D347A	probably damaging	Het
Arhgap28	C	T	17: 67,896,164		probably null	Het
Ccdc32	A	G	2: 119,027,129		probably benign	Het
Cdc42bpa	A	G	1: 180,144,835	T1401A	possibly damaging	Het
Celsr2	A	G	3: 108,412,623	Y958H	probably damaging	Het
Cenpe	A	G	3: 135,217,305	E137G	probably damaging	Het
Chd8	T	C	14: 52,213,433	D1399G	probably damaging	Het
Cntn3	T	C	6: 102,168,947	T978A	possibly damaging	Het
Col10a1	A	G	10: 34,395,696	T555A	possibly damaging	Het
Crybg3	A	C	16: 59,565,211		probably null	Het
Cts7	A	G	13: 61,355,734	F139L	probably damaging	Het
Dera	T	C	6: 137,796,747		probably benign	Het
Dgka	A	G	10: 128,723,260		probably benign	Het
Dhrs7	T	A	12: 72,652,351	I286F	probably damaging	Het
Dtwd2	A	G	18: 49,728,357		probably benign	Het
Fam160b2	T	C	14: 70,588,287	D351G	probably damaging	Het
Fermt1	A	G	2: 132,906,733	S657P	probably damaging	Het
Flnb	T	C	14: 7,890,810	V564A	probably benign	Het
Garnl3	A	G	2: 33,085,907	F16L	probably damaging	Het
Gck	T	C	11: 5,906,691	R191G	probably damaging	Het
Gucy1b1	A	T	3: 82,045,634		probably benign	Het
Ifna2	A	C	4: 88,683,658	L41R	probably damaging	Het
Krt33a	T	G	11: 100,012,715	E197A	probably damaging	Het
Lce1e	G	A	3: 92,707,756	R95C	unknown	Het
Lct	G	T	1: 128,308,234	S345R	probably benign	Het
Lrp2	A	T	2: 69,451,380	N3882K	probably benign	Het
Mcc	G	T	18: 44,445,860	T652K	possibly damaging	Het
Mier1	A	G	4: 103,139,502	S109G	probably benign	Het
Nfat5	A	G	8: 107,355,605	N469S	probably damaging	Het
Olfr382	C	A	11: 73,516,844	M118I	possibly damaging	Het
Olfr807	G	A	10: 129,755,402	T16I	probably damaging	Het
Piwil1	G	T	5: 128,743,307	R256M	probably null	Het
Rgma	T	C	7: 73,409,412	V88A	probably damaging	Het
Sdk2	T	C	11: 113,794,920		probably null	Het
Sec22b	A	G	3: 97,912,674	E94G	probably damaging	Het
Snrnp70	T	C	7: 45,387,245	R131G	possibly damaging	Het
Spata31d1a	A	G	13: 59,700,385	S1310P	possibly damaging	Het
Spint1	A	G	2: 119,246,467	E344G	probably damaging	Het
Srrm1	G	A	4: 135,324,991	Q141*	probably null	Het
Tep1	T	A	14: 50,866,844	K198*	probably null	Het
Tk2	A	G	8: 104,231,192	V174A	probably benign	Het
Txndc5	T	C	13: 38,507,896	K165E	probably damaging	Het
Ubr4	G	A	4: 139,423,906	R1884Q	probably damaging	Het
Vmn2r61	T	C	7: 42,300,420	Y755H	probably damaging	Het
Xrn1	T	A	9: 95,973,539	H296Q	probably damaging	Het
Zar1l	A	T	5: 150,512,942	V223D	probably damaging	Het

Other mutations in Tecta

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Tecta	APN	9	42332548	missense	probably damaging	1.00
IGL00925:Tecta	APN	9	42375035	missense	probably benign
IGL00960:Tecta	APN	9	42359080	missense	possibly damaging	0.74
IGL00974:Tecta	APN	9	42331374	missense	probably benign	0.00
IGL01070:Tecta	APN	9	42395003	missense	probably damaging	1.00
IGL01284:Tecta	APN	9	42345620	missense	probably damaging	1.00
IGL01324:Tecta	APN	9	42345431	missense	probably damaging	1.00
IGL01694:Tecta	APN	9	42367179	missense	possibly damaging	0.92
IGL01861:Tecta	APN	9	42373362	missense	probably benign
IGL02010:Tecta	APN	9	42337193	missense	probably damaging	0.97
IGL02397:Tecta	APN	9	42394998	missense	probably damaging	1.00
IGL03031:Tecta	APN	9	42345493	missense	probably benign
IGL03208:Tecta	APN	9	42337100	splice site	probably benign
IGL03249:Tecta	APN	9	42391886	missense	probably benign	0.20
R0004:Tecta	UTSW	9	42345478	missense	possibly damaging	0.74
R0045:Tecta	UTSW	9	42375191	missense	probably damaging	1.00
R0045:Tecta	UTSW	9	42375191	missense	probably damaging	1.00
R0119:Tecta	UTSW	9	42352063	missense	probably damaging	1.00
R0133:Tecta	UTSW	9	42367228	missense	probably benign	0.00
R0157:Tecta	UTSW	9	42375011	missense	probably benign
R0180:Tecta	UTSW	9	42366813	missense	probably benign
R0299:Tecta	UTSW	9	42352063	missense	probably damaging	1.00
R0345:Tecta	UTSW	9	42384218	missense	probably damaging	0.98
R0370:Tecta	UTSW	9	42366804	missense	probably benign
R0465:Tecta	UTSW	9	42359418	missense	possibly damaging	0.62
R0466:Tecta	UTSW	9	42373073	missense	probably benign
R0479:Tecta	UTSW	9	42337939	missense	probably damaging	1.00
R0498:Tecta	UTSW	9	42377614	missense	probably damaging	1.00
R0499:Tecta	UTSW	9	42352063	missense	probably damaging	1.00
R0519:Tecta	UTSW	9	42347892	splice site	probably benign
R0584:Tecta	UTSW	9	42347908	missense	possibly damaging	0.79
R0589:Tecta	UTSW	9	42345634	missense	probably benign	0.01
R0607:Tecta	UTSW	9	42388205	missense	probably damaging	1.00
R0905:Tecta	UTSW	9	42338994	missense	probably damaging	1.00
R1216:Tecta	UTSW	9	42377907	missense	probably benign	0.44
R1239:Tecta	UTSW	9	42332485	missense	probably damaging	1.00
R1442:Tecta	UTSW	9	42332482	missense	probably damaging	1.00
R1553:Tecta	UTSW	9	42348186	missense	probably damaging	1.00
R1727:Tecta	UTSW	9	42359301	missense	probably damaging	0.96
R1728:Tecta	UTSW	9	42391922	missense	probably benign	0.12
R1729:Tecta	UTSW	9	42391922	missense	probably benign	0.12
R1762:Tecta	UTSW	9	42375309	missense	probably benign	0.30
R1778:Tecta	UTSW	9	42343631	missense	probably damaging	1.00
R1795:Tecta	UTSW	9	42378049	missense	probably benign
R1796:Tecta	UTSW	9	42384197	missense	probably damaging	1.00
R1866:Tecta	UTSW	9	42392024	missense	probably damaging	0.97
R1871:Tecta	UTSW	9	42337176	missense	probably damaging	0.98
R1871:Tecta	UTSW	9	42337340	missense	probably damaging	1.00
R1911:Tecta	UTSW	9	42337936	missense	probably damaging	1.00
R2074:Tecta	UTSW	9	42337279	nonsense	probably null
R2135:Tecta	UTSW	9	42340285	missense	probably damaging	1.00
R2171:Tecta	UTSW	9	42358924	missense	probably damaging	0.99
R2220:Tecta	UTSW	9	42392030	missense	probably damaging	1.00
R2372:Tecta	UTSW	9	42388274	missense	probably damaging	1.00
R2570:Tecta	UTSW	9	42332552	missense	probably damaging	1.00
R2939:Tecta	UTSW	9	42377994	missense	possibly damaging	0.63
R2940:Tecta	UTSW	9	42377994	missense	possibly damaging	0.63
R3081:Tecta	UTSW	9	42377994	missense	possibly damaging	0.63
R3407:Tecta	UTSW	9	42337854	missense	probably damaging	1.00
R3732:Tecta	UTSW	9	42392106	missense	possibly damaging	0.95
R3771:Tecta	UTSW	9	42330996	missense	probably damaging	1.00
R3772:Tecta	UTSW	9	42330996	missense	probably damaging	1.00
R3773:Tecta	UTSW	9	42330996	missense	probably damaging	1.00
R3832:Tecta	UTSW	9	42339033	missense	probably damaging	1.00
R4378:Tecta	UTSW	9	42366708	missense	probably damaging	1.00
R4480:Tecta	UTSW	9	42373233	missense	possibly damaging	0.75
R4485:Tecta	UTSW	9	42337274	missense	possibly damaging	0.73
R4804:Tecta	UTSW	9	42398237	missense	probably benign
R4869:Tecta	UTSW	9	42375534	missense	probably benign	0.02
R4944:Tecta	UTSW	9	42330277	missense	probably benign	0.05
R5008:Tecta	UTSW	9	42373062	missense	possibly damaging	0.76
R5014:Tecta	UTSW	9	42373242	missense	probably damaging	1.00
R5125:Tecta	UTSW	9	42375185	missense	probably damaging	1.00
R5178:Tecta	UTSW	9	42375185	missense	probably damaging	1.00
R5180:Tecta	UTSW	9	42337208	missense	probably damaging	1.00
R5214:Tecta	UTSW	9	42345668	missense	probably benign	0.04
R5230:Tecta	UTSW	9	42394943	missense	probably damaging	0.96
R5330:Tecta	UTSW	9	42337856	missense	probably damaging	1.00
R5387:Tecta	UTSW	9	42375063	missense	probably damaging	0.98
R5614:Tecta	UTSW	9	42339055	missense	probably damaging	1.00
R5708:Tecta	UTSW	9	42338926	missense	probably damaging	1.00
R5738:Tecta	UTSW	9	42373178	missense	possibly damaging	0.63
R5770:Tecta	UTSW	9	42345589	missense	possibly damaging	0.94
R5839:Tecta	UTSW	9	42331023	missense	probably benign	0.03
R5839:Tecta	UTSW	9	42372976	missense	possibly damaging	0.86
R6119:Tecta	UTSW	9	42373075	missense	probably benign	0.00
R6246:Tecta	UTSW	9	42377908	missense	probably benign	0.07
R6377:Tecta	UTSW	9	42343755	missense	probably damaging	1.00
R6416:Tecta	UTSW	9	42375267	missense	probably damaging	0.97
R6595:Tecta	UTSW	9	42384227	missense	probably damaging	1.00
R6850:Tecta	UTSW	9	42343838	missense	probably benign	0.20
R6859:Tecta	UTSW	9	42392129	missense	probably damaging	1.00
R6861:Tecta	UTSW	9	42337337	missense	possibly damaging	0.93
R6939:Tecta	UTSW	9	42347997	missense	probably damaging	1.00
R6996:Tecta	UTSW	9	42366786	missense	probably benign
R7069:Tecta	UTSW	9	42394941	missense	probably benign	0.03
R7104:Tecta	UTSW	9	42366943	missense	probably benign	0.00
R7129:Tecta	UTSW	9	42347991	missense	probably damaging	1.00
R7220:Tecta	UTSW	9	42343887	missense	probably benign	0.05
R7251:Tecta	UTSW	9	42387752	missense	probably damaging	1.00
R7307:Tecta	UTSW	9	42377992	missense	probably damaging	1.00
R7343:Tecta	UTSW	9	42337332	missense	probably damaging	1.00
R7355:Tecta	UTSW	9	42367142	nonsense	probably null
R7635:Tecta	UTSW	9	42330987	missense	probably benign	0.11
R7653:Tecta	UTSW	9	42337236	missense	probably damaging	1.00
R7723:Tecta	UTSW	9	42366936	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGTAGACACTGTCGGGCCAAC -3'
(R):5'- GACTTTGCCACAGATGAAGGCAATG -3'

Sequencing Primer
(F):5'- GTAAGCACACGAGCCTTGG -3'
(R):5'- gctgagcgatgctgaatg -3'

Posted On

2014-09-10