Incidental Mutation 'R0691:Acy1'
ID 226042
Institutional Source Beutler Lab
Gene Symbol Acy1
Ensembl Gene ENSMUSG00000023262
Gene Name aminoacylase 1
Synonyms Acy-1, 1110014J22Rik
MMRRC Submission 038876-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0691 (G1)
Quality Score 36
Status Validated
Chromosome 9
Chromosomal Location 106310180-106315518 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 106313070 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024031] [ENSMUST00000048685] [ENSMUST00000059802] [ENSMUST00000098994] [ENSMUST00000150576] [ENSMUST00000171678] [ENSMUST00000190972] [ENSMUST00000190798] [ENSMUST00000213448] [ENSMUST00000185334] [ENSMUST00000187983] [ENSMUST00000187001] [ENSMUST00000190900] [ENSMUST00000171925] [ENSMUST00000190803] [ENSMUST00000215395] [ENSMUST00000215506] [ENSMUST00000214275] [ENSMUST00000214067] [ENSMUST00000217081] [ENSMUST00000216400]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000024031
SMART Domains Protein: ENSMUSP00000024031
Gene: ENSMUSG00000023262

DomainStartEndE-ValueType
Pfam:Peptidase_M28 61 239 8.6e-8 PFAM
Pfam:Peptidase_M20 76 397 1.8e-38 PFAM
Pfam:M20_dimer 188 302 1.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048685
SMART Domains Protein: ENSMUSP00000047322
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059802
SMART Domains Protein: ENSMUSP00000080203
Gene: ENSMUSG00000048758

DomainStartEndE-ValueType
Pfam:Ribosomal_L29e 3 42 1.4e-30 PFAM
low complexity region 126 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098994
SMART Domains Protein: ENSMUSP00000096592
Gene: ENSMUSG00000048758

DomainStartEndE-ValueType
Pfam:Ribosomal_L29e 3 42 2.6e-27 PFAM
low complexity region 126 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150576
SMART Domains Protein: ENSMUSP00000117834
Gene: ENSMUSG00000048758

DomainStartEndE-ValueType
Pfam:Ribosomal_L29e 3 42 9.8e-28 PFAM
low complexity region 126 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171678
SMART Domains Protein: ENSMUSP00000126101
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000190972
SMART Domains Protein: ENSMUSP00000139953
Gene: ENSMUSG00000023262

DomainStartEndE-ValueType
Pfam:Peptidase_M20 76 216 2.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190851
Predicted Effect probably benign
Transcript: ENSMUST00000190798
SMART Domains Protein: ENSMUSP00000141096
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 1.7e-8 PFAM
Pfam:Abhydrolase_5 73 157 1.2e-8 PFAM
Pfam:Abhydrolase_6 74 157 1.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213448
Predicted Effect probably benign
Transcript: ENSMUST00000185334
SMART Domains Protein: ENSMUSP00000140345
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187983
SMART Domains Protein: ENSMUSP00000140901
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Abhydrolase_5 73 203 5.4e-12 PFAM
Pfam:Abhydrolase_6 74 197 1.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187001
SMART Domains Protein: ENSMUSP00000140042
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
SCOP:d1imja_ 51 110 1e-10 SMART
PDB:1IMJ|A 58 110 6e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000190900
SMART Domains Protein: ENSMUSP00000140582
Gene: ENSMUSG00000023262

DomainStartEndE-ValueType
PDB:1Q7L|C 1 50 9e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000171925
SMART Domains Protein: ENSMUSP00000126916
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Abhydrolase_5 73 245 7.9e-17 PFAM
low complexity region 253 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190803
Predicted Effect probably null
Transcript: ENSMUST00000215395
Predicted Effect probably benign
Transcript: ENSMUST00000215506
Predicted Effect probably null
Transcript: ENSMUST00000214275
Predicted Effect probably benign
Transcript: ENSMUST00000214067
Predicted Effect probably benign
Transcript: ENSMUST00000217081
Predicted Effect probably benign
Transcript: ENSMUST00000217531
Predicted Effect probably benign
Transcript: ENSMUST00000216400
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic, homodimeric, zinc-binding enzyme that catalyzes the hydrolysis of acylated L-amino acids to L-amino acids and an acyl group, and has been postulated to function in the catabolism and salvage of acylated amino acids. This gene is located on chromosome 3p21.1, a region reduced to homozygosity in small-cell lung cancer (SCLC), and its expression has been reported to be reduced or undetectable in SCLC cell lines and tumors. The amino acid sequence of human aminoacylase-1 is highly homologous to the porcine counterpart, and this enzyme is the first member of a new family of zinc-binding enzymes. Mutations in this gene cause aminoacylase-1 deficiency, a metabolic disorder characterized by central nervous system defects and increased urinary excretion of N-acetylated amino acids. Alternative splicing of this gene results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream ABHD14A (abhydrolase domain containing 14A) gene, as represented in GeneID:100526760. A related pseudogene has been identified on chromosome 18. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,584,979 (GRCm39) D865G possibly damaging Het
Adcy4 A T 14: 56,010,104 (GRCm39) probably benign Het
Anpep T G 7: 79,489,047 (GRCm39) D347A probably damaging Het
Arhgap28 C T 17: 68,203,159 (GRCm39) probably null Het
Ccdc32 A G 2: 118,857,610 (GRCm39) probably benign Het
Cdc42bpa A G 1: 179,972,400 (GRCm39) T1401A possibly damaging Het
Celsr2 A G 3: 108,319,939 (GRCm39) Y958H probably damaging Het
Cenpe A G 3: 134,923,066 (GRCm39) E137G probably damaging Het
Chd8 T C 14: 52,450,890 (GRCm39) D1399G probably damaging Het
Cntn3 T C 6: 102,145,908 (GRCm39) T978A possibly damaging Het
Col10a1 A G 10: 34,271,692 (GRCm39) T555A possibly damaging Het
Crybg3 A C 16: 59,385,574 (GRCm39) probably null Het
Cts7 A G 13: 61,503,548 (GRCm39) F139L probably damaging Het
Dera T C 6: 137,773,745 (GRCm39) probably benign Het
Dgka A G 10: 128,559,129 (GRCm39) probably benign Het
Dhrs7 T A 12: 72,699,125 (GRCm39) I286F probably damaging Het
Dtwd2 A G 18: 49,861,424 (GRCm39) probably benign Het
Fermt1 A G 2: 132,748,653 (GRCm39) S657P probably damaging Het
Fhip2b T C 14: 70,825,727 (GRCm39) D351G probably damaging Het
Flnb T C 14: 7,890,810 (GRCm38) V564A probably benign Het
Garnl3 A G 2: 32,975,919 (GRCm39) F16L probably damaging Het
Gck T C 11: 5,856,691 (GRCm39) R191G probably damaging Het
Gucy1b1 A T 3: 81,952,941 (GRCm39) probably benign Het
Ifna2 A C 4: 88,601,895 (GRCm39) L41R probably damaging Het
Krt33a T G 11: 99,903,541 (GRCm39) E197A probably damaging Het
Lce1e G A 3: 92,615,063 (GRCm39) R95C unknown Het
Lct G T 1: 128,235,971 (GRCm39) S345R probably benign Het
Lrp2 A T 2: 69,281,724 (GRCm39) N3882K probably benign Het
Mcc G T 18: 44,578,927 (GRCm39) T652K possibly damaging Het
Mier1 A G 4: 102,996,699 (GRCm39) S109G probably benign Het
Nfat5 A G 8: 108,082,237 (GRCm39) N469S probably damaging Het
Or1e23 C A 11: 73,407,670 (GRCm39) M118I possibly damaging Het
Or6c214 G A 10: 129,591,271 (GRCm39) T16I probably damaging Het
Piwil1 G T 5: 128,820,371 (GRCm39) R256M probably null Het
Rgma T C 7: 73,059,160 (GRCm39) V88A probably damaging Het
Sdk2 T C 11: 113,685,746 (GRCm39) probably null Het
Sec22b A G 3: 97,819,990 (GRCm39) E94G probably damaging Het
Snrnp70 T C 7: 45,036,669 (GRCm39) R131G possibly damaging Het
Spata31d1a A G 13: 59,848,199 (GRCm39) S1310P possibly damaging Het
Spint1 A G 2: 119,076,948 (GRCm39) E344G probably damaging Het
Srrm1 G A 4: 135,052,302 (GRCm39) Q141* probably null Het
Tecta A T 9: 42,295,637 (GRCm39) L286Q probably damaging Het
Tep1 T A 14: 51,104,301 (GRCm39) K198* probably null Het
Tk2 A G 8: 104,957,824 (GRCm39) V174A probably benign Het
Txndc5 T C 13: 38,691,872 (GRCm39) K165E probably damaging Het
Ubr4 G A 4: 139,151,217 (GRCm39) R1884Q probably damaging Het
Vmn2r61 T C 7: 41,949,844 (GRCm39) Y755H probably damaging Het
Xrn1 T A 9: 95,855,592 (GRCm39) H296Q probably damaging Het
Zar1l A T 5: 150,436,407 (GRCm39) V223D probably damaging Het
Other mutations in Acy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Acy1 APN 9 106,314,006 (GRCm39) unclassified probably benign
IGL03029:Acy1 APN 9 106,312,314 (GRCm39) missense probably damaging 0.98
IGL03304:Acy1 APN 9 106,312,665 (GRCm39) critical splice donor site probably null
R2152:Acy1 UTSW 9 106,312,816 (GRCm39) missense probably damaging 1.00
R3882:Acy1 UTSW 9 106,312,708 (GRCm39) missense possibly damaging 0.75
R4019:Acy1 UTSW 9 106,313,978 (GRCm39) missense possibly damaging 0.94
R4421:Acy1 UTSW 9 106,312,912 (GRCm39) splice site probably null
R4700:Acy1 UTSW 9 106,310,782 (GRCm39) missense probably benign 0.00
R4931:Acy1 UTSW 9 106,310,390 (GRCm39) missense probably damaging 1.00
R4934:Acy1 UTSW 9 106,312,321 (GRCm39) missense probably null 1.00
R5030:Acy1 UTSW 9 106,310,596 (GRCm39) missense probably benign 0.31
R5482:Acy1 UTSW 9 106,311,838 (GRCm39) intron probably benign
R5748:Acy1 UTSW 9 106,313,926 (GRCm39) missense probably damaging 1.00
R6932:Acy1 UTSW 9 106,314,826 (GRCm39) critical splice donor site probably null
R7468:Acy1 UTSW 9 106,314,921 (GRCm39) start codon destroyed probably null 0.64
R7768:Acy1 UTSW 9 106,310,817 (GRCm39) missense possibly damaging 0.90
R8144:Acy1 UTSW 9 106,313,319 (GRCm39) splice site probably null
R8226:Acy1 UTSW 9 106,314,857 (GRCm39) missense probably damaging 0.98
R8692:Acy1 UTSW 9 106,310,377 (GRCm39) missense probably damaging 1.00
R8774:Acy1 UTSW 9 106,313,913 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Acy1 UTSW 9 106,313,913 (GRCm39) missense probably damaging 1.00
R9112:Acy1 UTSW 9 106,311,952 (GRCm39) missense probably benign 0.01
R9491:Acy1 UTSW 9 106,312,994 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGACCTCCTCGTCTGTAAAAGTG -3'
(R):5'- TGTCAGCATCCAGTGAGTATCCCC -3'

Sequencing Primer
(F):5'- CTCGTCTGTAAAAGTGTCAGGG -3'
(R):5'- GATGTGTTGAAAAACCCTAAGCC -3'
Posted On 2014-09-10