Incidental Mutation 'R0691:Olfr382'
ID226044
Institutional Source Beutler Lab
Gene Symbol Olfr382
Ensembl Gene ENSMUSG00000095312
Gene Nameolfactory receptor 382
SynonymsMOR135-31_p, MOR135-14, GA_x6K02T2P1NL-3676608-3675670
MMRRC Submission 038876-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R0691 (G1)
Quality Score79
Status Validated
Chromosome11
Chromosomal Location73516259-73517197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73516844 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 118 (M118I)
Ref Sequence ENSEMBL: ENSMUSP00000091575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092921]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092921
AA Change: M118I

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091575
Gene: ENSMUSG00000095312
AA Change: M118I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.9e-10 PFAM
Pfam:7tm_1 41 290 1.2e-24 PFAM
Meta Mutation Damage Score 0.1353 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,639,253 D865G possibly damaging Het
Acy1 A T 9: 106,435,871 probably null Het
Adcy4 A T 14: 55,772,647 probably benign Het
Anpep T G 7: 79,839,299 D347A probably damaging Het
Arhgap28 C T 17: 67,896,164 probably null Het
Ccdc32 A G 2: 119,027,129 probably benign Het
Cdc42bpa A G 1: 180,144,835 T1401A possibly damaging Het
Celsr2 A G 3: 108,412,623 Y958H probably damaging Het
Cenpe A G 3: 135,217,305 E137G probably damaging Het
Chd8 T C 14: 52,213,433 D1399G probably damaging Het
Cntn3 T C 6: 102,168,947 T978A possibly damaging Het
Col10a1 A G 10: 34,395,696 T555A possibly damaging Het
Crybg3 A C 16: 59,565,211 probably null Het
Cts7 A G 13: 61,355,734 F139L probably damaging Het
Dera T C 6: 137,796,747 probably benign Het
Dgka A G 10: 128,723,260 probably benign Het
Dhrs7 T A 12: 72,652,351 I286F probably damaging Het
Dtwd2 A G 18: 49,728,357 probably benign Het
Fam160b2 T C 14: 70,588,287 D351G probably damaging Het
Fermt1 A G 2: 132,906,733 S657P probably damaging Het
Flnb T C 14: 7,890,810 V564A probably benign Het
Garnl3 A G 2: 33,085,907 F16L probably damaging Het
Gck T C 11: 5,906,691 R191G probably damaging Het
Gucy1b1 A T 3: 82,045,634 probably benign Het
Ifna2 A C 4: 88,683,658 L41R probably damaging Het
Krt33a T G 11: 100,012,715 E197A probably damaging Het
Lce1e G A 3: 92,707,756 R95C unknown Het
Lct G T 1: 128,308,234 S345R probably benign Het
Lrp2 A T 2: 69,451,380 N3882K probably benign Het
Mcc G T 18: 44,445,860 T652K possibly damaging Het
Mier1 A G 4: 103,139,502 S109G probably benign Het
Nfat5 A G 8: 107,355,605 N469S probably damaging Het
Olfr807 G A 10: 129,755,402 T16I probably damaging Het
Piwil1 G T 5: 128,743,307 R256M probably null Het
Rgma T C 7: 73,409,412 V88A probably damaging Het
Sdk2 T C 11: 113,794,920 probably null Het
Sec22b A G 3: 97,912,674 E94G probably damaging Het
Snrnp70 T C 7: 45,387,245 R131G possibly damaging Het
Spata31d1a A G 13: 59,700,385 S1310P possibly damaging Het
Spint1 A G 2: 119,246,467 E344G probably damaging Het
Srrm1 G A 4: 135,324,991 Q141* probably null Het
Tecta A T 9: 42,384,341 L286Q probably damaging Het
Tep1 T A 14: 50,866,844 K198* probably null Het
Tk2 A G 8: 104,231,192 V174A probably benign Het
Txndc5 T C 13: 38,507,896 K165E probably damaging Het
Ubr4 G A 4: 139,423,906 R1884Q probably damaging Het
Vmn2r61 T C 7: 42,300,420 Y755H probably damaging Het
Xrn1 T A 9: 95,973,539 H296Q probably damaging Het
Zar1l A T 5: 150,512,942 V223D probably damaging Het
Other mutations in Olfr382
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Olfr382 APN 11 73516410 missense possibly damaging 0.59
IGL00896:Olfr382 APN 11 73516341 missense probably damaging 1.00
IGL01723:Olfr382 APN 11 73516626 missense probably damaging 1.00
IGL01734:Olfr382 APN 11 73516636 missense probably benign 0.39
IGL02267:Olfr382 APN 11 73516549 missense probably benign 0.44
IGL02681:Olfr382 APN 11 73516530 missense probably benign
IGL03165:Olfr382 APN 11 73516884 nonsense probably null
IGL03134:Olfr382 UTSW 11 73517115 missense probably benign 0.02
R0320:Olfr382 UTSW 11 73516924 missense probably damaging 1.00
R0633:Olfr382 UTSW 11 73516927 missense probably benign 0.23
R0638:Olfr382 UTSW 11 73516924 missense probably damaging 1.00
R1630:Olfr382 UTSW 11 73516720 missense probably damaging 1.00
R2269:Olfr382 UTSW 11 73516483 missense probably damaging 1.00
R4001:Olfr382 UTSW 11 73516986 missense probably damaging 1.00
R4925:Olfr382 UTSW 11 73517172 missense possibly damaging 0.87
R5707:Olfr382 UTSW 11 73516625 missense probably damaging 1.00
R5911:Olfr382 UTSW 11 73516525 missense probably damaging 1.00
R6225:Olfr382 UTSW 11 73517005 missense probably damaging 0.99
R6251:Olfr382 UTSW 11 73516708 missense probably benign 0.00
R6332:Olfr382 UTSW 11 73517175 missense probably benign 0.00
R7013:Olfr382 UTSW 11 73516421 nonsense probably null
R7196:Olfr382 UTSW 11 73517131 missense probably benign
R7443:Olfr382 UTSW 11 73516848 missense possibly damaging 0.89
Z1177:Olfr382 UTSW 11 73517035 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGAGCAAGCCAACTTGAGC -3'
(R):5'- AGTACCAGCACCTGTACTATGCCC -3'

Sequencing Primer
(F):5'- CCAACTTGAGCAGGGCAG -3'
(R):5'- TGGGGAACCTCATCATCATTATC -3'
Posted On2014-09-10