Incidental Mutation 'R0691:Spata31d1a'
ID226048
Institutional Source Beutler Lab
Gene Symbol Spata31d1a
Ensembl Gene ENSMUSG00000050876
Gene Namespermatogenesis associated 31 subfamily D, member 1A
Synonyms
MMRRC Submission 038876-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0691 (G1)
Quality Score56
Status Validated
Chromosome13
Chromosomal Location59699806-59710330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59700385 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1310 (S1310P)
Ref Sequence ENSEMBL: ENSMUSP00000152919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066510] [ENSMUST00000224469] [ENSMUST00000224982]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066510
AA Change: S1310P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128533
Gene: ENSMUSG00000050876
AA Change: S1310P

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:DUF4599 66 150 3.7e-25 PFAM
low complexity region 196 217 N/A INTRINSIC
low complexity region 240 266 N/A INTRINSIC
Pfam:FAM75 400 772 2.9e-108 PFAM
low complexity region 1144 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224469
Predicted Effect possibly damaging
Transcript: ENSMUST00000224982
AA Change: S1310P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225362
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,639,253 D865G possibly damaging Het
Acy1 A T 9: 106,435,871 probably null Het
Adcy4 A T 14: 55,772,647 probably benign Het
Anpep T G 7: 79,839,299 D347A probably damaging Het
Arhgap28 C T 17: 67,896,164 probably null Het
Ccdc32 A G 2: 119,027,129 probably benign Het
Cdc42bpa A G 1: 180,144,835 T1401A possibly damaging Het
Celsr2 A G 3: 108,412,623 Y958H probably damaging Het
Cenpe A G 3: 135,217,305 E137G probably damaging Het
Chd8 T C 14: 52,213,433 D1399G probably damaging Het
Cntn3 T C 6: 102,168,947 T978A possibly damaging Het
Col10a1 A G 10: 34,395,696 T555A possibly damaging Het
Crybg3 A C 16: 59,565,211 probably null Het
Cts7 A G 13: 61,355,734 F139L probably damaging Het
Dera T C 6: 137,796,747 probably benign Het
Dgka A G 10: 128,723,260 probably benign Het
Dhrs7 T A 12: 72,652,351 I286F probably damaging Het
Dtwd2 A G 18: 49,728,357 probably benign Het
Fam160b2 T C 14: 70,588,287 D351G probably damaging Het
Fermt1 A G 2: 132,906,733 S657P probably damaging Het
Flnb T C 14: 7,890,810 V564A probably benign Het
Garnl3 A G 2: 33,085,907 F16L probably damaging Het
Gck T C 11: 5,906,691 R191G probably damaging Het
Gucy1b1 A T 3: 82,045,634 probably benign Het
Ifna2 A C 4: 88,683,658 L41R probably damaging Het
Krt33a T G 11: 100,012,715 E197A probably damaging Het
Lce1e G A 3: 92,707,756 R95C unknown Het
Lct G T 1: 128,308,234 S345R probably benign Het
Lrp2 A T 2: 69,451,380 N3882K probably benign Het
Mcc G T 18: 44,445,860 T652K possibly damaging Het
Mier1 A G 4: 103,139,502 S109G probably benign Het
Nfat5 A G 8: 107,355,605 N469S probably damaging Het
Olfr382 C A 11: 73,516,844 M118I possibly damaging Het
Olfr807 G A 10: 129,755,402 T16I probably damaging Het
Piwil1 G T 5: 128,743,307 R256M probably null Het
Rgma T C 7: 73,409,412 V88A probably damaging Het
Sdk2 T C 11: 113,794,920 probably null Het
Sec22b A G 3: 97,912,674 E94G probably damaging Het
Snrnp70 T C 7: 45,387,245 R131G possibly damaging Het
Spint1 A G 2: 119,246,467 E344G probably damaging Het
Srrm1 G A 4: 135,324,991 Q141* probably null Het
Tecta A T 9: 42,384,341 L286Q probably damaging Het
Tep1 T A 14: 50,866,844 K198* probably null Het
Tk2 A G 8: 104,231,192 V174A probably benign Het
Txndc5 T C 13: 38,507,896 K165E probably damaging Het
Ubr4 G A 4: 139,423,906 R1884Q probably damaging Het
Vmn2r61 T C 7: 42,300,420 Y755H probably damaging Het
Xrn1 T A 9: 95,973,539 H296Q probably damaging Het
Zar1l A T 5: 150,512,942 V223D probably damaging Het
Other mutations in Spata31d1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Spata31d1a APN 13 59702185 missense probably benign 0.27
IGL01397:Spata31d1a APN 13 59701738 missense probably damaging 0.99
IGL01448:Spata31d1a APN 13 59701559 missense probably benign 0.06
IGL02715:Spata31d1a APN 13 59703735 missense probably benign 0.44
IGL02983:Spata31d1a APN 13 59703694 missense possibly damaging 0.65
IGL03224:Spata31d1a APN 13 59701026 missense possibly damaging 0.85
PIT1430001:Spata31d1a UTSW 13 59701196 missense probably benign
R0302:Spata31d1a UTSW 13 59703150 missense probably benign
R0387:Spata31d1a UTSW 13 59703501 missense probably damaging 0.99
R0464:Spata31d1a UTSW 13 59701759 missense possibly damaging 0.85
R0606:Spata31d1a UTSW 13 59702431 missense probably benign 0.03
R0617:Spata31d1a UTSW 13 59702259 missense possibly damaging 0.53
R0746:Spata31d1a UTSW 13 59702263 missense possibly damaging 0.95
R1019:Spata31d1a UTSW 13 59702368 missense probably benign
R1397:Spata31d1a UTSW 13 59705039 splice site probably benign
R1543:Spata31d1a UTSW 13 59702242 missense probably benign
R1619:Spata31d1a UTSW 13 59702433 nonsense probably null
R1799:Spata31d1a UTSW 13 59703402 missense probably benign
R1820:Spata31d1a UTSW 13 59701255 missense possibly damaging 0.86
R1885:Spata31d1a UTSW 13 59702007 missense probably damaging 0.99
R1909:Spata31d1a UTSW 13 59702695 missense probably damaging 0.99
R2012:Spata31d1a UTSW 13 59702556 missense possibly damaging 0.93
R2099:Spata31d1a UTSW 13 59706071 missense probably damaging 0.97
R2132:Spata31d1a UTSW 13 59701043 missense probably damaging 0.96
R2224:Spata31d1a UTSW 13 59703715 missense probably benign
R2225:Spata31d1a UTSW 13 59703715 missense probably benign
R2226:Spata31d1a UTSW 13 59703715 missense probably benign
R2358:Spata31d1a UTSW 13 59703888 missense probably benign 0.00
R2495:Spata31d1a UTSW 13 59701993 missense possibly damaging 0.93
R3081:Spata31d1a UTSW 13 59703093 missense probably benign 0.15
R3151:Spata31d1a UTSW 13 59701366 missense probably benign 0.06
R3971:Spata31d1a UTSW 13 59702157 missense possibly damaging 0.85
R4156:Spata31d1a UTSW 13 59705047 missense possibly damaging 0.92
R4760:Spata31d1a UTSW 13 59701645 missense probably damaging 1.00
R4767:Spata31d1a UTSW 13 59701155 missense probably benign 0.03
R4877:Spata31d1a UTSW 13 59702523 missense probably damaging 0.99
R4894:Spata31d1a UTSW 13 59701728 missense probably damaging 0.98
R4961:Spata31d1a UTSW 13 59701902 missense possibly damaging 0.86
R4990:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R4991:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R4992:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R5088:Spata31d1a UTSW 13 59701152 unclassified probably null
R5094:Spata31d1a UTSW 13 59705044 critical splice donor site probably null
R5330:Spata31d1a UTSW 13 59700403 missense possibly damaging 0.86
R5587:Spata31d1a UTSW 13 59702618 missense probably damaging 0.96
R5832:Spata31d1a UTSW 13 59701566 missense probably damaging 0.98
R6073:Spata31d1a UTSW 13 59702994 missense probably damaging 0.98
R6208:Spata31d1a UTSW 13 59700564 missense probably damaging 0.98
R6224:Spata31d1a UTSW 13 59706320 start gained probably benign
R6250:Spata31d1a UTSW 13 59701801 missense possibly damaging 0.93
R6359:Spata31d1a UTSW 13 59703106 missense probably benign
R6806:Spata31d1a UTSW 13 59703218 missense probably benign
R6848:Spata31d1a UTSW 13 59701963 missense possibly damaging 0.91
R6851:Spata31d1a UTSW 13 59703911 missense unknown
R6985:Spata31d1a UTSW 13 59703093 missense probably benign 0.15
R7007:Spata31d1a UTSW 13 59703634 missense probably benign
R7037:Spata31d1a UTSW 13 59700324 missense possibly damaging 0.96
R7124:Spata31d1a UTSW 13 59702487 missense probably damaging 0.99
R7271:Spata31d1a UTSW 13 59702099 missense probably benign 0.00
R7346:Spata31d1a UTSW 13 59703201 missense probably benign
R7556:Spata31d1a UTSW 13 59701984 missense probably benign 0.00
R7581:Spata31d1a UTSW 13 59704139 critical splice donor site probably null
R7891:Spata31d1a UTSW 13 59700325 missense possibly damaging 0.96
R7974:Spata31d1a UTSW 13 59700325 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCCTTCCACACAAAGAAGGGCAG -3'
(R):5'- GCCTCAGGAAAATCAGTTCACCAGC -3'

Sequencing Primer
(F):5'- AGGGCAGCCGGAAACTC -3'
(R):5'- GCTCTCCATTAGCATCTGGGAAG -3'
Posted On2014-09-10