Incidental Mutation 'R0691:Tep1'
ID226051
Institutional Source Beutler Lab
Gene Symbol Tep1
Ensembl Gene ENSMUSG00000006281
Gene Nametelomerase associated protein 1
SynonymsTp1
MMRRC Submission 038876-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0691 (G1)
Quality Score66
Status Validated
Chromosome14
Chromosomal Location50824059-50870560 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 50866844 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 198 (K198*)
Ref Sequence ENSEMBL: ENSMUSP00000006444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006444]
Predicted Effect probably null
Transcript: ENSMUST00000006444
AA Change: K198*
SMART Domains Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281
AA Change: K198*

DomainStartEndE-ValueType
Pfam:TEP1_N 1 29 2.8e-20 PFAM
Pfam:TEP1_N 31 59 1.4e-20 PFAM
Pfam:TEP1_N 61 89 3.1e-20 PFAM
Pfam:TEP1_N 91 119 3e-20 PFAM
low complexity region 195 207 N/A INTRINSIC
low complexity region 211 229 N/A INTRINSIC
Pfam:TROVE 230 685 3.2e-136 PFAM
Pfam:DUF4062 909 1020 2.4e-22 PFAM
Pfam:NACHT 1171 1346 9.2e-38 PFAM
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1622 1641 N/A INTRINSIC
WD40 1673 1711 2.98e-1 SMART
WD40 1714 1752 5.33e0 SMART
WD40 1755 1794 1.52e-4 SMART
WD40 1797 1835 3.27e-4 SMART
WD40 1838 1877 3.09e-1 SMART
WD40 1880 1919 2.24e-2 SMART
WD40 1925 1962 4.95e0 SMART
WD40 1968 2003 2.29e1 SMART
WD40 2008 2045 1.72e0 SMART
WD40 2058 2097 3.89e-11 SMART
WD40 2103 2142 3.93e-7 SMART
WD40 2145 2182 4.38e-5 SMART
WD40 2184 2232 1.24e0 SMART
WD40 2235 2273 1.14e-3 SMART
WD40 2275 2315 4.46e-1 SMART
Blast:WD40 2316 2353 4e-12 BLAST
WD40 2546 2583 6.79e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228254
Meta Mutation Damage Score 0.9710 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene show no obvious phenotype. No changes are seen in telomerase activity or telomere length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,639,253 D865G possibly damaging Het
Acy1 A T 9: 106,435,871 probably null Het
Adcy4 A T 14: 55,772,647 probably benign Het
Anpep T G 7: 79,839,299 D347A probably damaging Het
Arhgap28 C T 17: 67,896,164 probably null Het
Ccdc32 A G 2: 119,027,129 probably benign Het
Cdc42bpa A G 1: 180,144,835 T1401A possibly damaging Het
Celsr2 A G 3: 108,412,623 Y958H probably damaging Het
Cenpe A G 3: 135,217,305 E137G probably damaging Het
Chd8 T C 14: 52,213,433 D1399G probably damaging Het
Cntn3 T C 6: 102,168,947 T978A possibly damaging Het
Col10a1 A G 10: 34,395,696 T555A possibly damaging Het
Crybg3 A C 16: 59,565,211 probably null Het
Cts7 A G 13: 61,355,734 F139L probably damaging Het
Dera T C 6: 137,796,747 probably benign Het
Dgka A G 10: 128,723,260 probably benign Het
Dhrs7 T A 12: 72,652,351 I286F probably damaging Het
Dtwd2 A G 18: 49,728,357 probably benign Het
Fam160b2 T C 14: 70,588,287 D351G probably damaging Het
Fermt1 A G 2: 132,906,733 S657P probably damaging Het
Flnb T C 14: 7,890,810 V564A probably benign Het
Garnl3 A G 2: 33,085,907 F16L probably damaging Het
Gck T C 11: 5,906,691 R191G probably damaging Het
Gucy1b1 A T 3: 82,045,634 probably benign Het
Ifna2 A C 4: 88,683,658 L41R probably damaging Het
Krt33a T G 11: 100,012,715 E197A probably damaging Het
Lce1e G A 3: 92,707,756 R95C unknown Het
Lct G T 1: 128,308,234 S345R probably benign Het
Lrp2 A T 2: 69,451,380 N3882K probably benign Het
Mcc G T 18: 44,445,860 T652K possibly damaging Het
Mier1 A G 4: 103,139,502 S109G probably benign Het
Nfat5 A G 8: 107,355,605 N469S probably damaging Het
Olfr382 C A 11: 73,516,844 M118I possibly damaging Het
Olfr807 G A 10: 129,755,402 T16I probably damaging Het
Piwil1 G T 5: 128,743,307 R256M probably null Het
Rgma T C 7: 73,409,412 V88A probably damaging Het
Sdk2 T C 11: 113,794,920 probably null Het
Sec22b A G 3: 97,912,674 E94G probably damaging Het
Snrnp70 T C 7: 45,387,245 R131G possibly damaging Het
Spata31d1a A G 13: 59,700,385 S1310P possibly damaging Het
Spint1 A G 2: 119,246,467 E344G probably damaging Het
Srrm1 G A 4: 135,324,991 Q141* probably null Het
Tecta A T 9: 42,384,341 L286Q probably damaging Het
Tk2 A G 8: 104,231,192 V174A probably benign Het
Txndc5 T C 13: 38,507,896 K165E probably damaging Het
Ubr4 G A 4: 139,423,906 R1884Q probably damaging Het
Vmn2r61 T C 7: 42,300,420 Y755H probably damaging Het
Xrn1 T A 9: 95,973,539 H296Q probably damaging Het
Zar1l A T 5: 150,512,942 V223D probably damaging Het
Other mutations in Tep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Tep1 APN 14 50843184 missense probably damaging 1.00
IGL00490:Tep1 APN 14 50833473 missense probably damaging 0.97
IGL01114:Tep1 APN 14 50850639 missense probably damaging 0.98
IGL01294:Tep1 APN 14 50829657 splice site probably benign
IGL01902:Tep1 APN 14 50866091 splice site probably benign
IGL01910:Tep1 APN 14 50844112 missense probably benign 0.06
IGL01925:Tep1 APN 14 50824498 unclassified probably benign
IGL01965:Tep1 APN 14 50863495 splice site probably benign
IGL02071:Tep1 APN 14 50834049 missense possibly damaging 0.93
IGL02124:Tep1 APN 14 50854124 unclassified probably benign
IGL02189:Tep1 APN 14 50826826 missense probably benign
IGL02252:Tep1 APN 14 50830255 missense possibly damaging 0.93
IGL02299:Tep1 APN 14 50840671 missense probably damaging 0.99
IGL02343:Tep1 APN 14 50829247 missense probably damaging 0.99
IGL02423:Tep1 APN 14 50844620 missense possibly damaging 0.53
IGL02537:Tep1 APN 14 50836113 missense probably damaging 0.96
IGL02601:Tep1 APN 14 50833478 nonsense probably null
IGL02941:Tep1 APN 14 50866037 missense probably damaging 0.98
IGL02990:Tep1 APN 14 50868246 missense possibly damaging 0.86
IGL03144:Tep1 APN 14 50844017 splice site probably benign
IGL03209:Tep1 APN 14 50840703 splice site probably benign
PIT4305001:Tep1 UTSW 14 50829227 missense possibly damaging 0.90
PIT4362001:Tep1 UTSW 14 50866053 missense probably benign 0.23
R0058:Tep1 UTSW 14 50834065 missense possibly damaging 0.85
R0060:Tep1 UTSW 14 50866029 missense probably damaging 1.00
R0109:Tep1 UTSW 14 50851916 splice site probably null
R0123:Tep1 UTSW 14 50829693 missense possibly damaging 0.84
R0134:Tep1 UTSW 14 50829693 missense possibly damaging 0.84
R0148:Tep1 UTSW 14 50824789 missense possibly damaging 0.70
R0240:Tep1 UTSW 14 50863029 splice site probably benign
R0243:Tep1 UTSW 14 50846987 missense probably damaging 1.00
R0373:Tep1 UTSW 14 50836768 missense possibly damaging 0.85
R0432:Tep1 UTSW 14 50866823 small deletion probably benign
R0464:Tep1 UTSW 14 50847684 missense probably benign 0.00
R0566:Tep1 UTSW 14 50845414 critical splice donor site probably null
R0787:Tep1 UTSW 14 50829230 missense possibly damaging 0.85
R0972:Tep1 UTSW 14 50824296 unclassified probably benign
R1263:Tep1 UTSW 14 50845513 missense possibly damaging 0.84
R1300:Tep1 UTSW 14 50827055 critical splice donor site probably null
R1327:Tep1 UTSW 14 50853099 missense probably benign 0.18
R1556:Tep1 UTSW 14 50853042 missense probably benign 0.06
R1584:Tep1 UTSW 14 50866037 missense probably damaging 0.98
R1607:Tep1 UTSW 14 50824563 missense probably null 0.99
R1686:Tep1 UTSW 14 50836788 missense probably benign 0.12
R1715:Tep1 UTSW 14 50854567 missense possibly damaging 0.92
R1778:Tep1 UTSW 14 50829622 intron probably benign
R1993:Tep1 UTSW 14 50824184 missense possibly damaging 0.93
R2071:Tep1 UTSW 14 50854282 missense probably benign 0.23
R2104:Tep1 UTSW 14 50850580 splice site probably benign
R2118:Tep1 UTSW 14 50855572 intron probably null
R2119:Tep1 UTSW 14 50838986 missense probably benign 0.13
R2208:Tep1 UTSW 14 50866864 missense probably benign 0.01
R2241:Tep1 UTSW 14 50854210 missense probably benign 0.01
R2243:Tep1 UTSW 14 50854210 missense probably benign 0.01
R2311:Tep1 UTSW 14 50833567 missense possibly damaging 0.95
R2420:Tep1 UTSW 14 50834023 missense probably benign
R2874:Tep1 UTSW 14 50850650 missense possibly damaging 0.71
R3084:Tep1 UTSW 14 50827054 critical splice donor site probably null
R3086:Tep1 UTSW 14 50827054 critical splice donor site probably null
R3621:Tep1 UTSW 14 50829020 missense probably damaging 0.99
R3815:Tep1 UTSW 14 50868315 missense possibly damaging 0.71
R4124:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4125:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4127:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4134:Tep1 UTSW 14 50844860 missense probably benign
R4152:Tep1 UTSW 14 50837594 missense possibly damaging 0.72
R4153:Tep1 UTSW 14 50837594 missense possibly damaging 0.72
R4191:Tep1 UTSW 14 50836806 missense probably damaging 0.96
R4248:Tep1 UTSW 14 50862894 missense possibly damaging 0.93
R4293:Tep1 UTSW 14 50846861 missense probably benign
R4569:Tep1 UTSW 14 50824740 missense probably benign 0.01
R4704:Tep1 UTSW 14 50837073 missense probably benign 0.06
R4815:Tep1 UTSW 14 50841302 missense probably damaging 0.99
R4978:Tep1 UTSW 14 50845434 missense possibly damaging 0.93
R4989:Tep1 UTSW 14 50839000 missense probably benign
R5022:Tep1 UTSW 14 50828999 missense probably benign 0.27
R5057:Tep1 UTSW 14 50828999 missense probably benign 0.27
R5063:Tep1 UTSW 14 50850627 missense possibly damaging 0.86
R5118:Tep1 UTSW 14 50855587 splice site probably null
R5128:Tep1 UTSW 14 50844279 makesense probably null
R5149:Tep1 UTSW 14 50837398 nonsense probably null
R5171:Tep1 UTSW 14 50824802 missense probably benign 0.01
R5201:Tep1 UTSW 14 50868110 missense probably benign 0.01
R5260:Tep1 UTSW 14 50838631 missense probably benign
R5339:Tep1 UTSW 14 50844574 missense probably damaging 0.99
R5384:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5385:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5386:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5594:Tep1 UTSW 14 50829882 missense possibly damaging 0.86
R5639:Tep1 UTSW 14 50853605 missense possibly damaging 0.85
R5749:Tep1 UTSW 14 50844072 missense possibly damaging 0.59
R5756:Tep1 UTSW 14 50837379 critical splice donor site probably null
R6013:Tep1 UTSW 14 50861048 missense probably damaging 0.97
R6014:Tep1 UTSW 14 50847000 missense probably benign 0.12
R6248:Tep1 UTSW 14 50830258 missense probably damaging 0.98
R6264:Tep1 UTSW 14 50845513 missense probably damaging 0.99
R6363:Tep1 UTSW 14 50824548 missense probably benign 0.04
R6381:Tep1 UTSW 14 50845431 missense probably damaging 0.99
R6462:Tep1 UTSW 14 50844379 missense probably benign
R6942:Tep1 UTSW 14 50836737 missense possibly damaging 0.85
R6951:Tep1 UTSW 14 50833913 critical splice donor site probably null
R6979:Tep1 UTSW 14 50838637 missense possibly damaging 0.93
R6999:Tep1 UTSW 14 50850705 missense possibly damaging 0.86
R7099:Tep1 UTSW 14 50844487 intron probably null
R7208:Tep1 UTSW 14 50824556 critical splice acceptor site probably null
R7232:Tep1 UTSW 14 50844332 missense unknown
R7249:Tep1 UTSW 14 50824275 missense possibly damaging 0.86
R7325:Tep1 UTSW 14 50866038 missense probably damaging 0.99
R7409:Tep1 UTSW 14 50866855 missense possibly damaging 0.67
R7499:Tep1 UTSW 14 50853590 missense probably damaging 0.99
R7542:Tep1 UTSW 14 50862491 nonsense probably null
R7806:Tep1 UTSW 14 50836809 missense possibly damaging 0.85
R7825:Tep1 UTSW 14 50843887 critical splice acceptor site probably null
R7901:Tep1 UTSW 14 50826851 missense possibly damaging 0.88
R7984:Tep1 UTSW 14 50826851 missense possibly damaging 0.88
R8009:Tep1 UTSW 14 50824230 missense not run
RF007:Tep1 UTSW 14 50860945 missense possibly damaging 0.92
X0024:Tep1 UTSW 14 50827119 missense possibly damaging 0.86
X0060:Tep1 UTSW 14 50836764 missense probably benign 0.25
Z1177:Tep1 UTSW 14 50847765 missense not run
Predicted Primers PCR Primer
(F):5'- ACCTTCTTCTCCTGAAGGACCTGG -3'
(R):5'- TGCAGTCATGAAATGGCAGCGG -3'

Sequencing Primer
(F):5'- GTCAGTGGTTTCAGGATGAAAGC -3'
(R):5'- AAGACCACAGAGCATCTGAG -3'
Posted On2014-09-10