Mutagenetix > Incidental Mutations

Incidental Mutation 'R0691:Tep1'

226051

Institutional Source

Beutler Lab

Gene Symbol

Tep1

Ensembl Gene

ENSMUSG00000006281

Gene Name

telomerase associated protein 1

Synonyms

Tp1

MMRRC Submission

038876-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0691 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

50824059-50870560 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 50866844 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 198 (K198*)

Ref Sequence

ENSEMBL: ENSMUSP00000006444 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006444]

Predicted Effect

probably null
Transcript: ENSMUST00000006444
AA Change: K198*

SMART Domains

Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281
AA Change: K198*

Domain	Start	End	E-Value	Type
Pfam:TEP1_N	1	29	2.8e-20	PFAM
Pfam:TEP1_N	31	59	1.4e-20	PFAM
Pfam:TEP1_N	61	89	3.1e-20	PFAM
Pfam:TEP1_N	91	119	3e-20	PFAM
low complexity region	195	207	N/A	INTRINSIC
low complexity region	211	229	N/A	INTRINSIC
Pfam:TROVE	230	685	3.2e-136	PFAM
Pfam:DUF4062	909	1020	2.4e-22	PFAM
Pfam:NACHT	1171	1346	9.2e-38	PFAM
low complexity region	1393	1405	N/A	INTRINSIC
low complexity region	1622	1641	N/A	INTRINSIC
WD40	1673	1711	2.98e-1	SMART
WD40	1714	1752	5.33e0	SMART
WD40	1755	1794	1.52e-4	SMART
WD40	1797	1835	3.27e-4	SMART
WD40	1838	1877	3.09e-1	SMART
WD40	1880	1919	2.24e-2	SMART
WD40	1925	1962	4.95e0	SMART
WD40	1968	2003	2.29e1	SMART
WD40	2008	2045	1.72e0	SMART
WD40	2058	2097	3.89e-11	SMART
WD40	2103	2142	3.93e-7	SMART
WD40	2145	2182	4.38e-5	SMART
WD40	2184	2232	1.24e0	SMART
WD40	2235	2273	1.14e-3	SMART
WD40	2275	2315	4.46e-1	SMART
Blast:WD40	2316	2353	4e-12	BLAST
WD40	2546	2583	6.79e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181482

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181697

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227103

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227207

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227351

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228078

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228254

Meta Mutation Damage Score

0.9710

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.4%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene show no obvious phenotype. No changes are seen in telomerase activity or telomere length. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	T	C	6: 142,639,253	D865G	possibly damaging	Het
Acy1	A	T	9: 106,435,871		probably null	Het
Adcy4	A	T	14: 55,772,647		probably benign	Het
Anpep	T	G	7: 79,839,299	D347A	probably damaging	Het
Arhgap28	C	T	17: 67,896,164		probably null	Het
Ccdc32	A	G	2: 119,027,129		probably benign	Het
Cdc42bpa	A	G	1: 180,144,835	T1401A	possibly damaging	Het
Celsr2	A	G	3: 108,412,623	Y958H	probably damaging	Het
Cenpe	A	G	3: 135,217,305	E137G	probably damaging	Het
Chd8	T	C	14: 52,213,433	D1399G	probably damaging	Het
Cntn3	T	C	6: 102,168,947	T978A	possibly damaging	Het
Col10a1	A	G	10: 34,395,696	T555A	possibly damaging	Het
Crybg3	A	C	16: 59,565,211		probably null	Het
Cts7	A	G	13: 61,355,734	F139L	probably damaging	Het
Dera	T	C	6: 137,796,747		probably benign	Het
Dgka	A	G	10: 128,723,260		probably benign	Het
Dhrs7	T	A	12: 72,652,351	I286F	probably damaging	Het
Dtwd2	A	G	18: 49,728,357		probably benign	Het
Fam160b2	T	C	14: 70,588,287	D351G	probably damaging	Het
Fermt1	A	G	2: 132,906,733	S657P	probably damaging	Het
Flnb	T	C	14: 7,890,810	V564A	probably benign	Het
Garnl3	A	G	2: 33,085,907	F16L	probably damaging	Het
Gck	T	C	11: 5,906,691	R191G	probably damaging	Het
Gucy1b1	A	T	3: 82,045,634		probably benign	Het
Ifna2	A	C	4: 88,683,658	L41R	probably damaging	Het
Krt33a	T	G	11: 100,012,715	E197A	probably damaging	Het
Lce1e	G	A	3: 92,707,756	R95C	unknown	Het
Lct	G	T	1: 128,308,234	S345R	probably benign	Het
Lrp2	A	T	2: 69,451,380	N3882K	probably benign	Het
Mcc	G	T	18: 44,445,860	T652K	possibly damaging	Het
Mier1	A	G	4: 103,139,502	S109G	probably benign	Het
Nfat5	A	G	8: 107,355,605	N469S	probably damaging	Het
Olfr382	C	A	11: 73,516,844	M118I	possibly damaging	Het
Olfr807	G	A	10: 129,755,402	T16I	probably damaging	Het
Piwil1	G	T	5: 128,743,307	R256M	probably null	Het
Rgma	T	C	7: 73,409,412	V88A	probably damaging	Het
Sdk2	T	C	11: 113,794,920		probably null	Het
Sec22b	A	G	3: 97,912,674	E94G	probably damaging	Het
Snrnp70	T	C	7: 45,387,245	R131G	possibly damaging	Het
Spata31d1a	A	G	13: 59,700,385	S1310P	possibly damaging	Het
Spint1	A	G	2: 119,246,467	E344G	probably damaging	Het
Srrm1	G	A	4: 135,324,991	Q141*	probably null	Het
Tecta	A	T	9: 42,384,341	L286Q	probably damaging	Het
Tk2	A	G	8: 104,231,192	V174A	probably benign	Het
Txndc5	T	C	13: 38,507,896	K165E	probably damaging	Het
Ubr4	G	A	4: 139,423,906	R1884Q	probably damaging	Het
Vmn2r61	T	C	7: 42,300,420	Y755H	probably damaging	Het
Xrn1	T	A	9: 95,973,539	H296Q	probably damaging	Het
Zar1l	A	T	5: 150,512,942	V223D	probably damaging	Het

Other mutations in Tep1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Tep1	APN	14	50843184	missense	probably damaging	1.00
IGL00490:Tep1	APN	14	50833473	missense	probably damaging	0.97
IGL01114:Tep1	APN	14	50850639	missense	probably damaging	0.98
IGL01294:Tep1	APN	14	50829657	splice site	probably benign
IGL01902:Tep1	APN	14	50866091	splice site	probably benign
IGL01910:Tep1	APN	14	50844112	missense	probably benign	0.06
IGL01925:Tep1	APN	14	50824498	unclassified	probably benign
IGL01965:Tep1	APN	14	50863495	splice site	probably benign
IGL02071:Tep1	APN	14	50834049	missense	possibly damaging	0.93
IGL02124:Tep1	APN	14	50854124	unclassified	probably benign
IGL02189:Tep1	APN	14	50826826	missense	probably benign
IGL02252:Tep1	APN	14	50830255	missense	possibly damaging	0.93
IGL02299:Tep1	APN	14	50840671	missense	probably damaging	0.99
IGL02343:Tep1	APN	14	50829247	missense	probably damaging	0.99
IGL02423:Tep1	APN	14	50844620	missense	possibly damaging	0.53
IGL02537:Tep1	APN	14	50836113	missense	probably damaging	0.96
IGL02601:Tep1	APN	14	50833478	nonsense	probably null
IGL02941:Tep1	APN	14	50866037	missense	probably damaging	0.98
IGL02990:Tep1	APN	14	50868246	missense	possibly damaging	0.86
IGL03144:Tep1	APN	14	50844017	splice site	probably benign
IGL03209:Tep1	APN	14	50840703	splice site	probably benign
PIT4305001:Tep1	UTSW	14	50829227	missense	possibly damaging	0.90
PIT4362001:Tep1	UTSW	14	50866053	missense	probably benign	0.23
R0058:Tep1	UTSW	14	50834065	missense	possibly damaging	0.85
R0060:Tep1	UTSW	14	50866029	missense	probably damaging	1.00
R0109:Tep1	UTSW	14	50851916	splice site	probably null
R0123:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0134:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0148:Tep1	UTSW	14	50824789	missense	possibly damaging	0.70
R0240:Tep1	UTSW	14	50863029	splice site	probably benign
R0243:Tep1	UTSW	14	50846987	missense	probably damaging	1.00
R0373:Tep1	UTSW	14	50836768	missense	possibly damaging	0.85
R0432:Tep1	UTSW	14	50866823	small deletion	probably benign
R0464:Tep1	UTSW	14	50847684	missense	probably benign	0.00
R0566:Tep1	UTSW	14	50845414	critical splice donor site	probably null
R0787:Tep1	UTSW	14	50829230	missense	possibly damaging	0.85
R0972:Tep1	UTSW	14	50824296	unclassified	probably benign
R1263:Tep1	UTSW	14	50845513	missense	possibly damaging	0.84
R1300:Tep1	UTSW	14	50827055	critical splice donor site	probably null
R1327:Tep1	UTSW	14	50853099	missense	probably benign	0.18
R1556:Tep1	UTSW	14	50853042	missense	probably benign	0.06
R1584:Tep1	UTSW	14	50866037	missense	probably damaging	0.98
R1607:Tep1	UTSW	14	50824563	missense	probably null	0.99
R1686:Tep1	UTSW	14	50836788	missense	probably benign	0.12
R1715:Tep1	UTSW	14	50854567	missense	possibly damaging	0.92
R1778:Tep1	UTSW	14	50829622	intron	probably benign
R1993:Tep1	UTSW	14	50824184	missense	possibly damaging	0.93
R2071:Tep1	UTSW	14	50854282	missense	probably benign	0.23
R2104:Tep1	UTSW	14	50850580	splice site	probably benign
R2118:Tep1	UTSW	14	50855572	splice site	probably null
R2119:Tep1	UTSW	14	50838986	missense	probably benign	0.13
R2208:Tep1	UTSW	14	50866864	missense	probably benign	0.01
R2241:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2243:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2311:Tep1	UTSW	14	50833567	missense	possibly damaging	0.95
R2420:Tep1	UTSW	14	50834023	missense	probably benign
R2874:Tep1	UTSW	14	50850650	missense	possibly damaging	0.71
R3084:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3086:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3621:Tep1	UTSW	14	50829020	missense	probably damaging	0.99
R3815:Tep1	UTSW	14	50868315	missense	possibly damaging	0.71
R4124:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4125:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4127:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4134:Tep1	UTSW	14	50844860	missense	probably benign
R4152:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4153:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4191:Tep1	UTSW	14	50836806	missense	probably damaging	0.96
R4248:Tep1	UTSW	14	50862894	missense	possibly damaging	0.93
R4293:Tep1	UTSW	14	50846861	missense	probably benign
R4569:Tep1	UTSW	14	50824740	missense	probably benign	0.01
R4704:Tep1	UTSW	14	50837073	missense	probably benign	0.06
R4815:Tep1	UTSW	14	50841302	missense	probably damaging	0.99
R4978:Tep1	UTSW	14	50845434	missense	possibly damaging	0.93
R4989:Tep1	UTSW	14	50839000	missense	probably benign
R5022:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5057:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5063:Tep1	UTSW	14	50850627	missense	possibly damaging	0.86
R5118:Tep1	UTSW	14	50855587	splice site	probably null
R5128:Tep1	UTSW	14	50844279	makesense	probably null
R5149:Tep1	UTSW	14	50837398	nonsense	probably null
R5171:Tep1	UTSW	14	50824802	missense	probably benign	0.01
R5201:Tep1	UTSW	14	50868110	missense	probably benign	0.01
R5260:Tep1	UTSW	14	50838631	missense	probably benign
R5339:Tep1	UTSW	14	50844574	missense	probably damaging	0.99
R5384:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5385:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5386:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5594:Tep1	UTSW	14	50829882	missense	possibly damaging	0.86
R5639:Tep1	UTSW	14	50853605	missense	possibly damaging	0.85
R5749:Tep1	UTSW	14	50844072	missense	possibly damaging	0.59
R5756:Tep1	UTSW	14	50837379	critical splice donor site	probably null
R6013:Tep1	UTSW	14	50861048	missense	probably damaging	0.97
R6014:Tep1	UTSW	14	50847000	missense	probably benign	0.12
R6248:Tep1	UTSW	14	50830258	missense	probably damaging	0.98
R6264:Tep1	UTSW	14	50845513	missense	probably damaging	0.99
R6363:Tep1	UTSW	14	50824548	missense	probably benign	0.04
R6381:Tep1	UTSW	14	50845431	missense	probably damaging	0.99
R6462:Tep1	UTSW	14	50844379	missense	probably benign
R6942:Tep1	UTSW	14	50836737	missense	possibly damaging	0.85
R6951:Tep1	UTSW	14	50833913	critical splice donor site	probably null
R6979:Tep1	UTSW	14	50838637	missense	possibly damaging	0.93
R6999:Tep1	UTSW	14	50850705	missense	possibly damaging	0.86
R7099:Tep1	UTSW	14	50844487	splice site	probably null
R7208:Tep1	UTSW	14	50824556	critical splice acceptor site	probably null
R7232:Tep1	UTSW	14	50844332	missense	unknown
R7249:Tep1	UTSW	14	50824275	missense	possibly damaging	0.86
R7325:Tep1	UTSW	14	50866038	missense	probably damaging	0.99
R7409:Tep1	UTSW	14	50866855	missense	possibly damaging	0.67
R7499:Tep1	UTSW	14	50853590	missense	probably damaging	0.99
R7542:Tep1	UTSW	14	50862491	nonsense	probably null
R7806:Tep1	UTSW	14	50836809	missense	possibly damaging	0.85
R7825:Tep1	UTSW	14	50843887	critical splice acceptor site	probably null
R7901:Tep1	UTSW	14	50826851	missense	possibly damaging	0.88
R7961:Tep1	UTSW	14	50824230	missense	possibly damaging	0.93
R7993:Tep1	UTSW	14	50830253	missense	probably benign	0.41
R8009:Tep1	UTSW	14	50824230	missense	possibly damaging	0.93
R8085:Tep1	UTSW	14	50829296	missense	probably benign	0.11
R8299:Tep1	UTSW	14	50868045	missense	probably benign	0.06
R8330:Tep1	UTSW	14	50847705	missense	possibly damaging	0.86
R8396:Tep1	UTSW	14	50837072	missense	probably benign	0.23
R8475:Tep1	UTSW	14	50841255	missense	probably damaging	1.00
RF007:Tep1	UTSW	14	50860945	missense	possibly damaging	0.92
X0024:Tep1	UTSW	14	50827119	missense	possibly damaging	0.86
X0060:Tep1	UTSW	14	50836764	missense	probably benign	0.25
Z1177:Tep1	UTSW	14	50847765	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACCTTCTTCTCCTGAAGGACCTGG -3'
(R):5'- TGCAGTCATGAAATGGCAGCGG -3'

Sequencing Primer
(F):5'- GTCAGTGGTTTCAGGATGAAAGC -3'
(R):5'- AAGACCACAGAGCATCTGAG -3'

Posted On

2014-09-10