Incidental Mutation 'R0891:Gm5415'
ID226055
Institutional Source Beutler Lab
Gene Symbol Gm5415
Ensembl Gene ENSMUSG00000091318
Gene Namepredicted gene 5415
Synonyms
MMRRC Submission 039054-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R0891 (G1)
Quality Score32
Status Validated
Chromosome1
Chromosomal Location32543686-32547294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32546361 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 156 (H156L)
Ref Sequence ENSEMBL: ENSMUSP00000132789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027226] [ENSMUST00000171322]
Predicted Effect probably benign
Transcript: ENSMUST00000027226
SMART Domains Protein: ENSMUSP00000027226
Gene: ENSMUSG00000026058

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
KH 58 156 4.93e-7 SMART
low complexity region 185 197 N/A INTRINSIC
low complexity region 204 231 N/A INTRINSIC
Pfam:Sam68-YY 267 321 1.3e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171322
AA Change: H156L

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132789
Gene: ENSMUSG00000091318
AA Change: H156L

DomainStartEndE-ValueType
low complexity region 137 150 N/A INTRINSIC
Pfam:Peptidase_C48 298 477 7.4e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195761
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 96.7%
  • 20x: 92.2%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,290 N567K possibly damaging Het
9930021J03Rik G A 19: 29,717,653 T1547I probably damaging Het
Afap1 G A 5: 35,961,852 probably null Het
Angel2 G T 1: 190,945,073 K517N possibly damaging Het
Ankrd36 A G 11: 5,687,316 E1295G possibly damaging Het
Ankrd45 A G 1: 161,155,336 N139S possibly damaging Het
Ano3 T C 2: 110,697,976 T498A probably benign Het
Arhgap12 T C 18: 6,026,699 T720A probably damaging Het
Brsk1 A G 7: 4,704,227 S260G possibly damaging Het
Calml3 A G 13: 3,803,926 F93S probably damaging Het
Ccnf G T 17: 24,226,777 H498Q possibly damaging Het
Col27a1 A C 4: 63,305,183 probably null Het
Cpne5 A G 17: 29,202,919 probably benign Het
Dcst1 G A 3: 89,353,277 T560I probably benign Het
Fndc7 A G 3: 108,870,588 Y351H possibly damaging Het
Gen1 A G 12: 11,248,354 probably benign Het
Kcnh8 A T 17: 52,905,214 D680V probably damaging Het
Kmt2d A G 15: 98,852,691 probably benign Het
Lrrfip1 T A 1: 91,068,615 I50N probably damaging Het
Mbip A T 12: 56,340,457 D132E possibly damaging Het
Nipal3 A T 4: 135,468,587 I235N possibly damaging Het
Nup93 T A 8: 94,281,263 probably benign Het
Olfr1347 T A 7: 6,488,472 Y134F probably damaging Het
Olfr524 A G 7: 140,202,459 Y104H probably damaging Het
Pgbd1 T C 13: 21,422,800 Y408C probably damaging Het
Pigo G A 4: 43,020,519 Q808* probably null Het
Pik3r1 A T 13: 101,701,466 N299K probably benign Het
Pip5k1a A G 3: 95,065,520 probably benign Het
Sept5 G C 16: 18,624,845 T118R probably damaging Het
Smarcal1 T C 1: 72,598,856 V483A probably damaging Het
Togaram1 A G 12: 64,982,647 D948G probably benign Het
Vmn2r75 A T 7: 86,164,268 V442E possibly damaging Het
Zfp57 A G 17: 37,006,176 K46E probably damaging Het
Other mutations in Gm5415
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Gm5415 APN 1 32546667 missense probably benign
IGL01148:Gm5415 APN 1 32545654 missense possibly damaging 0.88
IGL02323:Gm5415 APN 1 32545704 nonsense probably null
IGL03076:Gm5415 APN 1 32545545 missense probably damaging 1.00
IGL03288:Gm5415 APN 1 32545760 missense probably benign 0.09
PIT4576001:Gm5415 UTSW 1 32546472 missense probably damaging 1.00
R0110:Gm5415 UTSW 1 32545875 missense possibly damaging 0.87
R0510:Gm5415 UTSW 1 32545875 missense possibly damaging 0.87
R1836:Gm5415 UTSW 1 32545677 missense probably damaging 1.00
R1939:Gm5415 UTSW 1 32545546 missense probably damaging 0.99
R2156:Gm5415 UTSW 1 32546047 missense probably benign 0.08
R2226:Gm5415 UTSW 1 32545853 missense probably damaging 1.00
R2422:Gm5415 UTSW 1 32545861 missense possibly damaging 0.73
R4761:Gm5415 UTSW 1 32546507 missense possibly damaging 0.51
R4901:Gm5415 UTSW 1 32546620 missense probably benign 0.00
R5129:Gm5415 UTSW 1 32545479 missense probably damaging 1.00
R5129:Gm5415 UTSW 1 32545480 missense probably damaging 1.00
R5184:Gm5415 UTSW 1 32545648 missense probably damaging 0.99
R5259:Gm5415 UTSW 1 32545517 nonsense probably null
R6271:Gm5415 UTSW 1 32545491 missense probably damaging 1.00
R6589:Gm5415 UTSW 1 32546711 missense probably benign 0.44
R6746:Gm5415 UTSW 1 32546763 missense probably benign
R7720:Gm5415 UTSW 1 32546097 missense probably benign 0.00
R7855:Gm5415 UTSW 1 32546033 missense probably damaging 0.96
R7938:Gm5415 UTSW 1 32546033 missense probably damaging 0.96
R8006:Gm5415 UTSW 1 32546924 start gained probably benign
X0024:Gm5415 UTSW 1 32545711 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- CTGTGTTCCAGGCTCCAAGCTATTC -3'
(R):5'- TGGCAAGGCTCAAAAGATGACCC -3'

Sequencing Primer
(F):5'- GCTCCAAGCTATTCCCCCTTC -3'
(R):5'- TAGAGTTGACCGAAGGTCCTC -3'
Posted On2014-09-10