Incidental Mutation 'R0147:Gm28042'
ID 22608
Institutional Source Beutler Lab
Gene Symbol Gm28042
Ensembl Gene ENSMUSG00000033852
Gene Name predicted gene, 28042
Synonyms
MMRRC Submission 038431-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.531) question?
Stock # R0147 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 2
Chromosomal Location 119857974-119873514 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119866944 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 196 (S196T)
Ref Sequence ENSEMBL: ENSMUSP00000118458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044675] [ENSMUST00000126150] [ENSMUST00000129685] [ENSMUST00000156805] [ENSMUST00000162393]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000044675
SMART Domains Protein: ENSMUSP00000041220
Gene: ENSMUSG00000098789

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 307 4.31e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125805
SMART Domains Protein: ENSMUSP00000122869
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
Pfam:Cupin_8 2 62 2.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126150
AA Change: S196T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118458
Gene: ENSMUSG00000098488
AA Change: S196T

DomainStartEndE-ValueType
C2 19 119 1.79e-17 SMART
PLAc 233 789 1.99e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129685
AA Change: S419T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115498
Gene: ENSMUSG00000033852
AA Change: S419T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 308 1.65e-4 SMART
C2 242 342 1.79e-17 SMART
PLAc 456 1012 1.99e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134380
Predicted Effect probably benign
Transcript: ENSMUST00000156805
AA Change: S419T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117535
Gene: ENSMUSG00000033852
AA Change: S419T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 308 1.65e-4 SMART
C2 242 342 1.79e-17 SMART
PLAc 456 892 8.56e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136042
Predicted Effect probably benign
Transcript: ENSMUST00000162393
SMART Domains Protein: ENSMUSP00000125329
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 242 4.42e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.1%
Validation Efficiency 67% (88/131)
MGI Phenotype FUNCTION: This locus represents naturally-occurring readthrough transcription between the neighboring Jmjd7 (jumonji domain containing 7) and Pla2g4b (phospholipase A2, group IVB (cytosolic)) genes on chromosome 2. The readthrough transcript is a candidate for nonsense-mediated mRNA decay (NMD), and is unlikely to produce a protein product. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,639,405 (GRCm39) probably null Het
Abtb2 A G 2: 103,397,480 (GRCm39) I137V probably benign Het
Ank1 T A 8: 23,613,993 (GRCm39) N1545K probably damaging Het
Arl6 T C 16: 59,439,153 (GRCm39) probably benign Het
Avl9 T A 6: 56,713,487 (GRCm39) D248E probably benign Het
Becn1 T C 11: 101,192,562 (GRCm39) E40G probably damaging Het
Bod1l G T 5: 41,976,040 (GRCm39) A1758E possibly damaging Het
Btbd16 C T 7: 130,381,324 (GRCm39) T19I probably damaging Het
Casc3 T A 11: 98,713,325 (GRCm39) N246K possibly damaging Het
Celf1 G T 2: 90,835,035 (GRCm39) probably benign Het
Chrm3 G T 13: 9,928,780 (GRCm39) N85K probably damaging Het
Cluh T A 11: 74,556,764 (GRCm39) Y935N probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Col6a5 T C 9: 105,802,993 (GRCm39) D1324G unknown Het
Ctcfl T C 2: 172,960,340 (GRCm39) D81G possibly damaging Het
D630003M21Rik C T 2: 158,044,987 (GRCm39) probably benign Het
Ddx39a C T 8: 84,449,105 (GRCm39) R298C possibly damaging Het
Dnmt3b T G 2: 153,503,377 (GRCm39) N9K possibly damaging Het
Dock8 T C 19: 25,096,823 (GRCm39) L577P probably benign Het
Drc1 A T 5: 30,486,487 (GRCm39) N13I possibly damaging Het
Eml4 T A 17: 83,729,081 (GRCm39) N85K probably damaging Het
Epb41l4a T C 18: 33,931,853 (GRCm39) T581A probably damaging Het
Epha3 T C 16: 63,433,307 (GRCm39) D446G possibly damaging Het
Fam209 G T 2: 172,315,900 (GRCm39) G92C probably damaging Het
Fam98c T A 7: 28,852,146 (GRCm39) R340* probably null Het
Fbxw10 T G 11: 62,738,307 (GRCm39) probably null Het
Galr1 A G 18: 82,423,695 (GRCm39) L194P probably benign Het
Gar1 T C 3: 129,623,122 (GRCm39) H89R probably damaging Het
Gbp4 T A 5: 105,267,362 (GRCm39) Y519F probably benign Het
Grid2 T C 6: 64,510,571 (GRCm39) Y734H probably benign Het
Grm6 T A 11: 50,750,144 (GRCm39) I466N possibly damaging Het
Hectd3 T C 4: 116,854,237 (GRCm39) probably benign Het
Hpse2 A C 19: 42,920,099 (GRCm39) probably null Het
Hspb7 T C 4: 141,151,302 (GRCm39) I148T probably damaging Het
Htr1d C A 4: 136,170,788 (GRCm39) T339K probably damaging Het
Ip6k1 T A 9: 107,923,093 (GRCm39) D408E probably damaging Het
Irs2 A T 8: 11,057,568 (GRCm39) M288K probably damaging Het
Kansl3 A T 1: 36,392,897 (GRCm39) C225S probably damaging Het
Knop1 C A 7: 118,445,061 (GRCm39) R301L probably benign Het
Lama5 T C 2: 179,832,199 (GRCm39) H1714R probably benign Het
Mettl14 G A 3: 123,165,043 (GRCm39) T316I probably damaging Het
Mmp15 A T 8: 96,098,945 (GRCm39) N591Y probably benign Het
Mprip T A 11: 59,627,899 (GRCm39) D93E possibly damaging Het
Mtmr14 T A 6: 113,237,627 (GRCm39) probably benign Het
Muc5ac T C 7: 141,364,776 (GRCm39) S1917P probably benign Het
Muc6 C T 7: 141,238,255 (GRCm39) C75Y probably damaging Het
Naip1 A T 13: 100,563,418 (GRCm39) H582Q possibly damaging Het
Nbeal2 G A 9: 110,471,211 (GRCm39) R264* probably null Het
Neb T C 2: 52,139,388 (GRCm39) K140E probably damaging Het
Nfya A G 17: 48,706,026 (GRCm39) V48A possibly damaging Het
Ngf G T 3: 102,417,119 (GRCm39) probably benign Het
Nsmce2 T G 15: 59,250,806 (GRCm39) S26A probably damaging Het
Or52s19 T C 7: 103,007,613 (GRCm39) T263A possibly damaging Het
Or5m13b T A 2: 85,754,362 (GRCm39) I250N possibly damaging Het
Or7e177 T G 9: 20,212,387 (GRCm39) M297R probably damaging Het
Pax1 A G 2: 147,215,654 (GRCm39) S424G probably benign Het
Pcdhb19 A T 18: 37,630,235 (GRCm39) Q10L probably benign Het
Pdcl T C 2: 37,242,142 (GRCm39) I203V probably benign Het
Pknox1 T A 17: 31,823,764 (GRCm39) N379K probably benign Het
Plxna1 C T 6: 89,297,692 (GRCm39) A1831T possibly damaging Het
Prodh T G 16: 17,895,677 (GRCm39) Q360P probably damaging Het
Pygo2 T C 3: 89,340,610 (GRCm39) V299A probably damaging Het
Raf1 C T 6: 115,609,934 (GRCm39) G202S probably benign Het
Rgs11 T A 17: 26,426,433 (GRCm39) probably null Het
Rmc1 C T 18: 12,322,328 (GRCm39) R594C probably damaging Het
Rnf13 A G 3: 57,709,889 (GRCm39) D144G probably damaging Het
Rtel1 T C 2: 180,962,839 (GRCm39) C31R probably damaging Het
Rubcnl T A 14: 75,279,898 (GRCm39) I427K probably damaging Het
Sec23ip C T 7: 128,380,775 (GRCm39) probably benign Het
Slc25a26 T A 6: 94,569,507 (GRCm39) probably null Het
Slc6a7 A G 18: 61,135,183 (GRCm39) probably benign Het
Slco6b1 A T 1: 96,915,562 (GRCm39) noncoding transcript Het
Spata17 A G 1: 186,844,798 (GRCm39) V111A probably damaging Het
Spata22 T A 11: 73,221,979 (GRCm39) M1K probably null Het
Svep1 C T 4: 58,116,608 (GRCm39) D881N possibly damaging Het
Sypl2 T A 3: 108,126,411 (GRCm39) N67I possibly damaging Het
Tasor A G 14: 27,193,725 (GRCm39) D975G probably benign Het
Tenm3 T C 8: 48,689,755 (GRCm39) Y1944C probably damaging Het
Tm9sf4 G T 2: 153,037,233 (GRCm39) V365L probably benign Het
Tmc3 T C 7: 83,256,950 (GRCm39) V401A probably damaging Het
Trpm2 C T 10: 77,761,659 (GRCm39) G997D probably damaging Het
Unc5b A T 10: 60,608,076 (GRCm39) S675T probably damaging Het
Vmn1r217 A G 13: 23,298,107 (GRCm39) M265T probably benign Het
Vps54 T A 11: 21,250,259 (GRCm39) D548E probably benign Het
Wdfy3 A G 5: 102,065,277 (GRCm39) V1297A probably benign Het
Wdr46 T A 17: 34,159,997 (GRCm39) F70I probably benign Het
Zdbf2 C T 1: 63,343,165 (GRCm39) Q515* probably null Het
Zfp710 T A 7: 79,731,721 (GRCm39) C299* probably null Het
Other mutations in Gm28042
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Gm28042 APN 2 119,860,837 (GRCm39) missense probably damaging 1.00
IGL01148:Gm28042 APN 2 119,869,519 (GRCm39) missense possibly damaging 0.74
IGL02005:Gm28042 APN 2 119,865,115 (GRCm39) missense possibly damaging 0.95
IGL02237:Gm28042 APN 2 119,870,380 (GRCm39) missense possibly damaging 0.61
IGL02539:Gm28042 APN 2 119,865,702 (GRCm39) missense probably damaging 1.00
IGL02747:Gm28042 APN 2 119,861,875 (GRCm39) missense probably damaging 1.00
IGL02825:Gm28042 APN 2 119,862,125 (GRCm39) missense probably damaging 0.99
IGL02998:Gm28042 APN 2 119,870,635 (GRCm39) missense possibly damaging 0.70
IGL03057:Gm28042 APN 2 119,862,637 (GRCm39) missense probably damaging 1.00
IGL03084:Gm28042 APN 2 119,870,986 (GRCm39) missense probably benign 0.08
IGL03160:Gm28042 APN 2 119,866,309 (GRCm39) missense possibly damaging 0.94
PIT4520001:Gm28042 UTSW 2 119,870,148 (GRCm39) nonsense probably null
R0270:Gm28042 UTSW 2 119,872,073 (GRCm39) missense probably benign 0.06
R0315:Gm28042 UTSW 2 119,869,538 (GRCm39) missense probably damaging 1.00
R1421:Gm28042 UTSW 2 119,866,944 (GRCm39) missense probably benign 0.00
R1589:Gm28042 UTSW 2 119,871,887 (GRCm39) missense probably benign 0.05
R1599:Gm28042 UTSW 2 119,866,944 (GRCm39) missense probably benign 0.00
R1656:Gm28042 UTSW 2 119,869,370 (GRCm39) missense probably damaging 1.00
R1718:Gm28042 UTSW 2 119,866,872 (GRCm39) missense possibly damaging 0.78
R1969:Gm28042 UTSW 2 119,872,096 (GRCm39) makesense probably null
R2164:Gm28042 UTSW 2 119,867,229 (GRCm39) missense probably benign 0.01
R2275:Gm28042 UTSW 2 119,867,310 (GRCm39) missense probably damaging 1.00
R3976:Gm28042 UTSW 2 119,867,237 (GRCm39) missense probably benign 0.11
R4483:Gm28042 UTSW 2 119,866,321 (GRCm39) missense possibly damaging 0.68
R4614:Gm28042 UTSW 2 119,871,639 (GRCm39) missense probably damaging 0.99
R4802:Gm28042 UTSW 2 119,872,535 (GRCm39) utr 3 prime probably benign
R4976:Gm28042 UTSW 2 119,865,124 (GRCm39) missense probably damaging 1.00
R5119:Gm28042 UTSW 2 119,865,124 (GRCm39) missense probably damaging 1.00
R5177:Gm28042 UTSW 2 119,872,082 (GRCm39) splice site probably null
R5340:Gm28042 UTSW 2 119,871,929 (GRCm39) missense probably benign
R5861:Gm28042 UTSW 2 119,865,116 (GRCm39) missense probably damaging 1.00
R6641:Gm28042 UTSW 2 119,870,164 (GRCm39) missense probably damaging 1.00
R7187:Gm28042 UTSW 2 119,870,176 (GRCm39) missense probably damaging 1.00
R7488:Gm28042 UTSW 2 119,870,438 (GRCm39) missense probably benign 0.00
R7699:Gm28042 UTSW 2 119,870,197 (GRCm39) missense possibly damaging 0.81
R7700:Gm28042 UTSW 2 119,870,197 (GRCm39) missense possibly damaging 0.81
R8432:Gm28042 UTSW 2 119,869,077 (GRCm39) missense probably damaging 1.00
R9120:Gm28042 UTSW 2 119,869,462 (GRCm39) missense probably damaging 0.96
R9265:Gm28042 UTSW 2 119,871,705 (GRCm39) missense probably damaging 1.00
R9803:Gm28042 UTSW 2 119,868,984 (GRCm39) missense possibly damaging 0.88
X0019:Gm28042 UTSW 2 119,870,139 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGTCAGAGACGATTTCCCTGC -3'
(R):5'- GAGAAAGGACCCTGCGAGTCATTAC -3'

Sequencing Primer
(F):5'- CAGACTTGATAAGGCATTCCGTG -3'
(R):5'- TAACTCCCTGTGGCAAGGAC -3'
Posted On 2013-04-16