Incidental Mutation 'R0147:Dnmt3b'
ID22610
Institutional Source Beutler Lab
Gene Symbol Dnmt3b
Ensembl Gene ENSMUSG00000027478
Gene NameDNA methyltransferase 3B
Synonyms
MMRRC Submission 038431-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0147 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location153649450-153687730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 153661457 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 9 (N9K)
Ref Sequence ENSEMBL: ENSMUSP00000105396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056495] [ENSMUST00000072997] [ENSMUST00000081628] [ENSMUST00000088976] [ENSMUST00000103150] [ENSMUST00000103151] [ENSMUST00000109771] [ENSMUST00000109772] [ENSMUST00000109773] [ENSMUST00000109774]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056495
AA Change: N9K

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051830
Gene: ENSMUSG00000027478
AA Change: N9K

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 582 732 3.1e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000072997
AA Change: N9K

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072761
Gene: ENSMUSG00000027478
AA Change: N9K

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 581 731 4.5e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000081628
AA Change: N9K

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080334
Gene: ENSMUSG00000027478
AA Change: N9K

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 1e-54 PDB
Blast:RING 463 512 7e-28 BLAST
Pfam:DNA_methylase 561 711 4.4e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000088976
AA Change: N9K

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000086370
Gene: ENSMUSG00000027478
AA Change: N9K

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 7e-55 PDB
Blast:RING 483 532 5e-28 BLAST
Pfam:DNA_methylase 581 727 2.9e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103150
AA Change: N9K

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099439
Gene: ENSMUSG00000027478
AA Change: N9K

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 8e-55 PDB
Blast:RING 463 512 6e-28 BLAST
Pfam:DNA_methylase 561 707 4.2e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103151
AA Change: N9K

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099440
Gene: ENSMUSG00000027478
AA Change: N9K

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 8e-55 PDB
Blast:RING 463 512 6e-28 BLAST
Pfam:DNA_methylase 561 707 4.2e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109771
AA Change: N9K

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105393
Gene: ENSMUSG00000027478
AA Change: N9K

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 582 732 3.1e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109772
AA Change: N9K

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105394
Gene: ENSMUSG00000027478
AA Change: N9K

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 7e-55 PDB
Blast:RING 483 532 5e-28 BLAST
Pfam:DNA_methylase 581 727 2.9e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109773
AA Change: N9K

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105395
Gene: ENSMUSG00000027478
AA Change: N9K

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 1e-54 PDB
Blast:RING 463 512 7e-28 BLAST
Pfam:DNA_methylase 561 711 4.4e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109774
AA Change: N9K

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105396
Gene: ENSMUSG00000027478
AA Change: N9K

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 581 731 4.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132132
Meta Mutation Damage Score 0.0622 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.1%
Validation Efficiency 67% (88/131)
MGI Phenotype FUNCTION: This is one of two related genes encoding de novo DNA methyltransferases, which are responsible for the establishment of DNA methylation patterns in embryos. Loss of function of this gene results in severe developmental defects and loss of viability. Mutation of the related gene in humans causes immunodeficiency-centromeric instability-facial anomalies (ICF) syndrome. There is a pseudogene for this gene located adjacent to this gene in the same region of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit growth retardation and rostral neural tube defects, and die prenatally. Mutants exhibit slight under-methylation of endogenous viral DNA and substantial demethylation of minor satellite DNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,189,271 R594C probably damaging Het
A2m T C 6: 121,662,446 probably null Het
Abtb2 A G 2: 103,567,135 I137V probably benign Het
Ank1 T A 8: 23,123,977 N1545K probably damaging Het
Arl6 T C 16: 59,618,790 probably benign Het
Avl9 T A 6: 56,736,502 D248E probably benign Het
Becn1 T C 11: 101,301,736 E40G probably damaging Het
Bod1l G T 5: 41,818,697 A1758E possibly damaging Het
Btbd16 C T 7: 130,779,594 T19I probably damaging Het
Casc3 T A 11: 98,822,499 N246K possibly damaging Het
Celf1 G T 2: 91,004,690 probably benign Het
Chrm3 G T 13: 9,878,744 N85K probably damaging Het
Cluh T A 11: 74,665,938 Y935N probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col6a5 T C 9: 105,925,794 D1324G unknown Het
Ctcfl T C 2: 173,118,547 D81G possibly damaging Het
D630003M21Rik C T 2: 158,203,067 probably benign Het
Ddx39 C T 8: 83,722,476 R298C possibly damaging Het
Dock8 T C 19: 25,119,459 L577P probably benign Het
Drc1 A T 5: 30,281,489 N13I possibly damaging Het
Eml4 T A 17: 83,421,652 N85K probably damaging Het
Epb41l4a T C 18: 33,798,800 T581A probably damaging Het
Epha3 T C 16: 63,612,944 D446G possibly damaging Het
Fam208a A G 14: 27,471,768 D975G probably benign Het
Fam209 G T 2: 172,473,980 G92C probably damaging Het
Fam98c T A 7: 29,152,721 R340* probably null Het
Fbxw10 T G 11: 62,847,481 probably null Het
Galr1 A G 18: 82,405,570 L194P probably benign Het
Gar1 T C 3: 129,829,473 H89R probably damaging Het
Gbp4 T A 5: 105,119,496 Y519F probably benign Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Grid2 T C 6: 64,533,587 Y734H probably benign Het
Grm6 T A 11: 50,859,317 I466N possibly damaging Het
Hectd3 T C 4: 116,997,040 probably benign Het
Hpse2 A C 19: 42,931,660 probably null Het
Hspb7 T C 4: 141,423,991 I148T probably damaging Het
Htr1d C A 4: 136,443,477 T339K probably damaging Het
Ip6k1 T A 9: 108,045,894 D408E probably damaging Het
Irs2 A T 8: 11,007,568 M288K probably damaging Het
Kansl3 A T 1: 36,353,816 C225S probably damaging Het
Knop1 C A 7: 118,845,838 R301L probably benign Het
Lama5 T C 2: 180,190,406 H1714R probably benign Het
Mettl14 G A 3: 123,371,394 T316I probably damaging Het
Mmp15 A T 8: 95,372,317 N591Y probably benign Het
Mprip T A 11: 59,737,073 D93E possibly damaging Het
Mtmr14 T A 6: 113,260,666 probably benign Het
Muc5ac T C 7: 141,811,039 S1917P probably benign Het
Muc6 C T 7: 141,651,990 C75Y probably damaging Het
Naip1 A T 13: 100,426,910 H582Q possibly damaging Het
Nbeal2 G A 9: 110,642,143 R264* probably null Het
Neb T C 2: 52,249,376 K140E probably damaging Het
Nfya A G 17: 48,398,998 V48A possibly damaging Het
Ngf G T 3: 102,509,803 probably benign Het
Nsmce2 T G 15: 59,378,957 S26A probably damaging Het
Olfr1026 T A 2: 85,924,018 I250N possibly damaging Het
Olfr601 T C 7: 103,358,406 T263A possibly damaging Het
Olfr873 T G 9: 20,301,091 M297R probably damaging Het
Pax1 A G 2: 147,373,734 S424G probably benign Het
Pcdhb19 A T 18: 37,497,182 Q10L probably benign Het
Pdcl T C 2: 37,352,130 I203V probably benign Het
Pknox1 T A 17: 31,604,790 N379K probably benign Het
Plxna1 C T 6: 89,320,710 A1831T possibly damaging Het
Prodh T G 16: 18,077,813 Q360P probably damaging Het
Pygo2 T C 3: 89,433,303 V299A probably damaging Het
Raf1 C T 6: 115,632,973 G202S probably benign Het
Rgs11 T A 17: 26,207,459 probably null Het
Rnf13 A G 3: 57,802,468 D144G probably damaging Het
Rtel1 T C 2: 181,321,046 C31R probably damaging Het
Rubcnl T A 14: 75,042,458 I427K probably damaging Het
Sec23ip C T 7: 128,779,051 probably benign Het
Slc25a26 T A 6: 94,592,526 probably null Het
Slc6a7 A G 18: 61,002,111 probably benign Het
Slco6b1 A T 1: 96,987,837 noncoding transcript Het
Spata17 A G 1: 187,112,601 V111A probably damaging Het
Spata22 T A 11: 73,331,153 M1K probably null Het
Svep1 C T 4: 58,116,608 D881N possibly damaging Het
Sypl2 T A 3: 108,219,095 N67I possibly damaging Het
Tenm3 T C 8: 48,236,720 Y1944C probably damaging Het
Tm9sf4 G T 2: 153,195,313 V365L probably benign Het
Tmc3 T C 7: 83,607,742 V401A probably damaging Het
Trpm2 C T 10: 77,925,825 G997D probably damaging Het
Unc5b A T 10: 60,772,297 S675T probably damaging Het
Vmn1r217 A G 13: 23,113,937 M265T probably benign Het
Vps54 T A 11: 21,300,259 D548E probably benign Het
Wdfy3 A G 5: 101,917,411 V1297A probably benign Het
Wdr46 T A 17: 33,941,023 F70I probably benign Het
Zdbf2 C T 1: 63,304,006 Q515* probably null Het
Zfp710 T A 7: 80,081,973 C299* probably null Het
Other mutations in Dnmt3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Dnmt3b APN 2 153672502 missense possibly damaging 0.88
IGL00931:Dnmt3b APN 2 153686250 splice site probably benign
IGL01073:Dnmt3b APN 2 153670842 splice site probably benign
IGL01138:Dnmt3b APN 2 153661441 missense probably benign 0.01
IGL01960:Dnmt3b APN 2 153676711 missense possibly damaging 0.83
IGL02884:Dnmt3b APN 2 153674377 missense probably damaging 1.00
IGL03382:Dnmt3b APN 2 153686359 missense probably damaging 1.00
PIT4151001:Dnmt3b UTSW 2 153684479 critical splice donor site probably null
R0062:Dnmt3b UTSW 2 153672272 missense probably benign 0.01
R0122:Dnmt3b UTSW 2 153676698 missense probably damaging 1.00
R0178:Dnmt3b UTSW 2 153675018 missense probably benign 0.41
R0751:Dnmt3b UTSW 2 153674842 intron probably null
R1696:Dnmt3b UTSW 2 153676710 nonsense probably null
R1795:Dnmt3b UTSW 2 153683639 missense possibly damaging 0.92
R1889:Dnmt3b UTSW 2 153676759 missense probably benign
R2898:Dnmt3b UTSW 2 153667630 missense possibly damaging 0.85
R4201:Dnmt3b UTSW 2 153670417 nonsense probably null
R4630:Dnmt3b UTSW 2 153670315 nonsense probably null
R4870:Dnmt3b UTSW 2 153670364 missense probably benign 0.01
R5648:Dnmt3b UTSW 2 153677198 missense probably damaging 1.00
R5814:Dnmt3b UTSW 2 153672497 missense probably benign 0.00
R6311:Dnmt3b UTSW 2 153674005 missense probably damaging 1.00
R6625:Dnmt3b UTSW 2 153665313 missense probably benign
R6818:Dnmt3b UTSW 2 153686284 missense probably damaging 1.00
R7258:Dnmt3b UTSW 2 153683599 splice site probably null
R7473:Dnmt3b UTSW 2 153684450 missense probably damaging 1.00
R7570:Dnmt3b UTSW 2 153676699 missense probably damaging 1.00
R7627:Dnmt3b UTSW 2 153677580 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATCAGGGGCATTGATCCCATCAAG -3'
(R):5'- GTCATGGAACCTGCCGTATCTGAG -3'

Sequencing Primer
(F):5'- TGGAACCAAGTTCTGAGCC -3'
(R):5'- GCCGTATCTGAGCTTTGACAC -3'
Posted On2013-04-16