Mutagenetix > Incidental Mutation

Incidental Mutation 'R1116:Pax2'

226125

Institutional Source

Beutler Lab

Gene Symbol

Pax2

Ensembl Gene

ENSMUSG00000004231

Gene Name

paired box 2

Synonyms

Pax-2, Opdc

MMRRC Submission

039189-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1116 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

44756045-44837871 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 44757424 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 11 (S11P)

Ref Sequence

ENSEMBL: ENSMUSP00000004340 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004340] [ENSMUST00000173346] [ENSMUST00000174490]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000004340
AA Change: S11P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000004340
Gene: ENSMUSG00000004231
AA Change: S11P

Domain	Start	End	E-Value	Type
PAX	15	139	4e-96	SMART
low complexity region	165	177	N/A	INTRINSIC
SCOP:d1ftt__	246	280	1e-4	SMART
Pfam:Pax2_C	300	415	1.1e-55	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172880
AA Change: S11P

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000134174
Gene: ENSMUSG00000004231
AA Change: S11P

Domain	Start	End	E-Value	Type
PAX	16	140	2.3e-96	SMART
low complexity region	166	178	N/A	INTRINSIC
SCOP:d1ftt__	247	281	7e-5	SMART
Pfam:Pax2_C	304	415	5.5e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173346

SMART Domains

Protein: ENSMUSP00000134311
Gene: ENSMUSG00000004231

Domain	Start	End	E-Value	Type
PAX	20	144	2.3e-96	SMART
low complexity region	170	182	N/A	INTRINSIC
SCOP:d1ftt__	220	254	5e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174490
AA Change: S11P

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000134661
Gene: ENSMUSG00000004231
AA Change: S11P

Domain	Start	End	E-Value	Type
PAX	16	140	2.3e-96	SMART
low complexity region	166	178	N/A	INTRINSIC
SCOP:d1ftt__	224	258	8e-5	SMART
Pfam:Pax2_C	278	393	6.3e-57	PFAM

Meta Mutation Damage Score

0.1789

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 92.8%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAX2 encodes paired box gene 2, one of many human homologues of the Drosophila melanogaster gene prd. The central feature of this transcription factor gene family is the conserved DNA-binding paired box domain. PAX2 is believed to be a target of transcriptional supression by the tumor suppressor gene WT1. Mutations within PAX2 have been shown to result in optic nerve colobomas and renal hypoplasia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous targeted and spontaneous null mutants show impaired to absent development of optic nerve, retina, kidney, ureters, genital tracts, inner ear and midhindbrain. Heterozygotes show milder defects of the optic nerve, retina and kidney. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230019H11Rik	A	T	10: 3,120,180		noncoding transcript	Het
Abi3bp	T	C	16: 56,686,429		probably benign	Het
Acacb	C	T	5: 114,210,956	P1028S	probably damaging	Het
Acad10	A	G	5: 121,630,751	F717S	probably damaging	Het
Adgrg6	A	T	10: 14,438,428	Y705N	probably benign	Het
Adm	A	G	7: 110,628,294	I6V	probably benign	Het
Agps	T	G	2: 75,861,925		probably benign	Het
Atr	C	T	9: 95,867,636	Q501*	probably null	Het
Cacna2d3	A	G	14: 29,064,321		probably benign	Het
Ccnt1	G	A	15: 98,544,338	R350W	probably damaging	Het
Cfap74	G	A	4: 155,433,996	E564K	probably benign	Het
Clip1	T	C	5: 123,579,491	E1250G	probably damaging	Het
Cryz	A	C	3: 154,621,603		probably benign	Het
Dnah1	C	A	14: 31,307,867	V494F	probably benign	Het
Dpep3	G	T	8: 105,978,829	D96E	probably damaging	Het
Dyrk3	G	A	1: 131,129,182	A418V	probably damaging	Het
Ehf	T	A	2: 103,267,009	N231I	probably damaging	Het
Eif4g3	T	C	4: 138,091,775		probably null	Het
Ergic3	G	A	2: 156,016,787	V278M	probably benign	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam178b	A	T	1: 36,578,588	C82*	probably null	Het
Gm1647	C	T	3: 69,156,872	Q31*	probably null	Het
Got1	T	A	19: 43,502,974	K346*	probably null	Het
Grid2ip	G	A	5: 143,382,914	G656D	possibly damaging	Het
Grm2	A	G	9: 106,647,927	Y530H	probably damaging	Het
Hyou1	T	C	9: 44,384,681	I381T	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
March11	T	C	15: 26,409,295	L360P	probably damaging	Het
Mettl17	T	C	14: 51,889,598	V281A	probably benign	Het
Micu2	A	T	14: 57,954,200	D131E	probably benign	Het
Mug1	G	C	6: 121,870,645	V661L	probably benign	Het
Myo18b	A	T	5: 112,803,279	D1488E	probably damaging	Het
Nkg7	G	A	7: 43,437,454	V51I	probably benign	Het
Nlgn1	A	C	3: 25,433,874	S766A	probably benign	Het
Olfr462	T	A	11: 87,889,408	M163L	probably benign	Het
Otog	T	C	7: 46,300,601		probably benign	Het
Pck2	A	G	14: 55,545,366	D392G	probably benign	Het
Plxnd1	A	T	6: 115,967,005		probably null	Het
Prkdc	A	G	16: 15,783,079	D2868G	probably benign	Het
Prl3d2	T	C	13: 27,126,002	L149P	probably damaging	Het
Purg	A	T	8: 33,386,745	H137L	probably benign	Het
Slc38a8	A	T	8: 119,496,133	L150Q	probably damaging	Het
Tifab	T	A	13: 56,176,212	R139S	possibly damaging	Het
Txndc16	T	C	14: 45,162,985	H353R	probably benign	Het
Upk2	A	G	9: 44,453,789		probably null	Het
Zdhhc25	G	A	15: 88,600,620	V53I	probably benign	Het
Zfp738	T	A	13: 67,670,243		probably null	Het
Zfp810	C	T	9: 22,279,085	E176K	probably benign	Het
Zfp846	T	A	9: 20,593,263	W140R	possibly damaging	Het

Other mutations in Pax2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01341:Pax2	APN	19	44790688	missense	probably damaging	0.99
IGL02368:Pax2	APN	19	44835409	missense	possibly damaging	0.55
IGL03146:Pax2	APN	19	44833275	splice site	probably benign
R0084:Pax2	UTSW	19	44818435	missense	probably damaging	1.00
R0554:Pax2	UTSW	19	44761861	missense	probably damaging	1.00
R1951:Pax2	UTSW	19	44788832	missense	probably benign	0.09
R1952:Pax2	UTSW	19	44788832	missense	probably benign	0.09
R1981:Pax2	UTSW	19	44818465	missense	probably damaging	1.00
R3015:Pax2	UTSW	19	44816024	missense	probably damaging	1.00
R4320:Pax2	UTSW	19	44835399	missense	probably damaging	0.97
R4561:Pax2	UTSW	19	44835963	missense	unknown
R4562:Pax2	UTSW	19	44835963	missense	unknown
R4661:Pax2	UTSW	19	44760937	missense	probably damaging	1.00
R4948:Pax2	UTSW	19	44816040	missense	probably damaging	1.00
R5131:Pax2	UTSW	19	44760955	missense	probably damaging	0.98
R5622:Pax2	UTSW	19	44818466	missense	probably damaging	1.00
R5661:Pax2	UTSW	19	44790722	missense	probably damaging	1.00
R6110:Pax2	UTSW	19	44790736	missense	probably damaging	0.99
R6171:Pax2	UTSW	19	44790740	missense	probably damaging	1.00
R6713:Pax2	UTSW	19	44835477	missense	unknown
R6791:Pax2	UTSW	19	44788821	missense	possibly damaging	0.69
R7156:Pax2	UTSW	19	44788859	missense	probably benign	0.00
R7679:Pax2	UTSW	19	44760937	missense	probably damaging	1.00
R7695:Pax2	UTSW	19	44833199	missense	probably damaging	1.00
R8005:Pax2	UTSW	19	44760889	missense	probably damaging	1.00
R8555:Pax2	UTSW	19	44761689	missense	probably damaging	1.00
R8849:Pax2	UTSW	19	44760672	intron	probably benign
R8878:Pax2	UTSW	19	44788776	critical splice acceptor site	probably null
R9043:Pax2	UTSW	19	44816060	missense	probably benign	0.00
R9103:Pax2	UTSW	19	44818529	missense	probably benign	0.00
X0018:Pax2	UTSW	19	44796676	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TTGGTTCAGAGCCTCTCGGACAAC -3'
(R):5'- CCTTTAGTCCAGGGCAAAGACTGAC -3'

Sequencing Primer
(F):5'- AGCTGAGTGAGCCGTCTTC -3'
(R):5'- AACCGTGAGTATGGCGTG -3'

Posted On

2014-09-15