Incidental Mutation 'R1116:Pax2'
ID 226125
Institutional Source Beutler Lab
Gene Symbol Pax2
Ensembl Gene ENSMUSG00000004231
Gene Name paired box 2
Synonyms Pax-2, Opdc
MMRRC Submission 039189-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1116 (G1)
Quality Score 75
Status Validated
Chromosome 19
Chromosomal Location 44756045-44837871 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44757424 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 11 (S11P)
Ref Sequence ENSEMBL: ENSMUSP00000004340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004340] [ENSMUST00000173346] [ENSMUST00000174490]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000004340
AA Change: S11P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000004340
Gene: ENSMUSG00000004231
AA Change: S11P

DomainStartEndE-ValueType
PAX 15 139 4e-96 SMART
low complexity region 165 177 N/A INTRINSIC
SCOP:d1ftt__ 246 280 1e-4 SMART
Pfam:Pax2_C 300 415 1.1e-55 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172880
AA Change: S11P

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134174
Gene: ENSMUSG00000004231
AA Change: S11P

DomainStartEndE-ValueType
PAX 16 140 2.3e-96 SMART
low complexity region 166 178 N/A INTRINSIC
SCOP:d1ftt__ 247 281 7e-5 SMART
Pfam:Pax2_C 304 415 5.5e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173346
SMART Domains Protein: ENSMUSP00000134311
Gene: ENSMUSG00000004231

DomainStartEndE-ValueType
PAX 20 144 2.3e-96 SMART
low complexity region 170 182 N/A INTRINSIC
SCOP:d1ftt__ 220 254 5e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174490
AA Change: S11P

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134661
Gene: ENSMUSG00000004231
AA Change: S11P

DomainStartEndE-ValueType
PAX 16 140 2.3e-96 SMART
low complexity region 166 178 N/A INTRINSIC
SCOP:d1ftt__ 224 258 8e-5 SMART
Pfam:Pax2_C 278 393 6.3e-57 PFAM
Meta Mutation Damage Score 0.1789 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAX2 encodes paired box gene 2, one of many human homologues of the Drosophila melanogaster gene prd. The central feature of this transcription factor gene family is the conserved DNA-binding paired box domain. PAX2 is believed to be a target of transcriptional supression by the tumor suppressor gene WT1. Mutations within PAX2 have been shown to result in optic nerve colobomas and renal hypoplasia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous targeted and spontaneous null mutants show impaired to absent development of optic nerve, retina, kidney, ureters, genital tracts, inner ear and midhindbrain. Heterozygotes show milder defects of the optic nerve, retina and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik A T 10: 3,120,180 noncoding transcript Het
Abi3bp T C 16: 56,686,429 probably benign Het
Acacb C T 5: 114,210,956 P1028S probably damaging Het
Acad10 A G 5: 121,630,751 F717S probably damaging Het
Adgrg6 A T 10: 14,438,428 Y705N probably benign Het
Adm A G 7: 110,628,294 I6V probably benign Het
Agps T G 2: 75,861,925 probably benign Het
Atr C T 9: 95,867,636 Q501* probably null Het
Cacna2d3 A G 14: 29,064,321 probably benign Het
Ccnt1 G A 15: 98,544,338 R350W probably damaging Het
Cfap74 G A 4: 155,433,996 E564K probably benign Het
Clip1 T C 5: 123,579,491 E1250G probably damaging Het
Cryz A C 3: 154,621,603 probably benign Het
Dnah1 C A 14: 31,307,867 V494F probably benign Het
Dpep3 G T 8: 105,978,829 D96E probably damaging Het
Dyrk3 G A 1: 131,129,182 A418V probably damaging Het
Ehf T A 2: 103,267,009 N231I probably damaging Het
Eif4g3 T C 4: 138,091,775 probably null Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam178b A T 1: 36,578,588 C82* probably null Het
Gm1647 C T 3: 69,156,872 Q31* probably null Het
Got1 T A 19: 43,502,974 K346* probably null Het
Grid2ip G A 5: 143,382,914 G656D possibly damaging Het
Grm2 A G 9: 106,647,927 Y530H probably damaging Het
Hyou1 T C 9: 44,384,681 I381T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
March11 T C 15: 26,409,295 L360P probably damaging Het
Mettl17 T C 14: 51,889,598 V281A probably benign Het
Micu2 A T 14: 57,954,200 D131E probably benign Het
Mug1 G C 6: 121,870,645 V661L probably benign Het
Myo18b A T 5: 112,803,279 D1488E probably damaging Het
Nkg7 G A 7: 43,437,454 V51I probably benign Het
Nlgn1 A C 3: 25,433,874 S766A probably benign Het
Olfr462 T A 11: 87,889,408 M163L probably benign Het
Otog T C 7: 46,300,601 probably benign Het
Pck2 A G 14: 55,545,366 D392G probably benign Het
Plxnd1 A T 6: 115,967,005 probably null Het
Prkdc A G 16: 15,783,079 D2868G probably benign Het
Prl3d2 T C 13: 27,126,002 L149P probably damaging Het
Purg A T 8: 33,386,745 H137L probably benign Het
Slc38a8 A T 8: 119,496,133 L150Q probably damaging Het
Tifab T A 13: 56,176,212 R139S possibly damaging Het
Txndc16 T C 14: 45,162,985 H353R probably benign Het
Upk2 A G 9: 44,453,789 probably null Het
Zdhhc25 G A 15: 88,600,620 V53I probably benign Het
Zfp738 T A 13: 67,670,243 probably null Het
Zfp810 C T 9: 22,279,085 E176K probably benign Het
Zfp846 T A 9: 20,593,263 W140R possibly damaging Het
Other mutations in Pax2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Pax2 APN 19 44790688 missense probably damaging 0.99
IGL02368:Pax2 APN 19 44835409 missense possibly damaging 0.55
IGL03146:Pax2 APN 19 44833275 splice site probably benign
R0084:Pax2 UTSW 19 44818435 missense probably damaging 1.00
R0554:Pax2 UTSW 19 44761861 missense probably damaging 1.00
R1951:Pax2 UTSW 19 44788832 missense probably benign 0.09
R1952:Pax2 UTSW 19 44788832 missense probably benign 0.09
R1981:Pax2 UTSW 19 44818465 missense probably damaging 1.00
R3015:Pax2 UTSW 19 44816024 missense probably damaging 1.00
R4320:Pax2 UTSW 19 44835399 missense probably damaging 0.97
R4561:Pax2 UTSW 19 44835963 missense unknown
R4562:Pax2 UTSW 19 44835963 missense unknown
R4661:Pax2 UTSW 19 44760937 missense probably damaging 1.00
R4948:Pax2 UTSW 19 44816040 missense probably damaging 1.00
R5131:Pax2 UTSW 19 44760955 missense probably damaging 0.98
R5622:Pax2 UTSW 19 44818466 missense probably damaging 1.00
R5661:Pax2 UTSW 19 44790722 missense probably damaging 1.00
R6110:Pax2 UTSW 19 44790736 missense probably damaging 0.99
R6171:Pax2 UTSW 19 44790740 missense probably damaging 1.00
R6713:Pax2 UTSW 19 44835477 missense unknown
R6791:Pax2 UTSW 19 44788821 missense possibly damaging 0.69
R7156:Pax2 UTSW 19 44788859 missense probably benign 0.00
R7679:Pax2 UTSW 19 44760937 missense probably damaging 1.00
R7695:Pax2 UTSW 19 44833199 missense probably damaging 1.00
R8005:Pax2 UTSW 19 44760889 missense probably damaging 1.00
R8555:Pax2 UTSW 19 44761689 missense probably damaging 1.00
R8849:Pax2 UTSW 19 44760672 intron probably benign
R8878:Pax2 UTSW 19 44788776 critical splice acceptor site probably null
R9043:Pax2 UTSW 19 44816060 missense probably benign 0.00
R9103:Pax2 UTSW 19 44818529 missense probably benign 0.00
X0018:Pax2 UTSW 19 44796676 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGGTTCAGAGCCTCTCGGACAAC -3'
(R):5'- CCTTTAGTCCAGGGCAAAGACTGAC -3'

Sequencing Primer
(F):5'- AGCTGAGTGAGCCGTCTTC -3'
(R):5'- AACCGTGAGTATGGCGTG -3'
Posted On 2014-09-15