Incidental Mutation 'R0656:Vmn1r8'
ID 226141
Institutional Source Beutler Lab
Gene Symbol Vmn1r8
Ensembl Gene ENSMUSG00000061208
Gene Name vomeronasal 1 receptor 8
Synonyms V1rc32
MMRRC Submission 038841-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock # R0656 (G1)
Quality Score 49
Status Validated
Chromosome 6
Chromosomal Location 57032284-57037391 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57036588 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 208 (Q208L)
Ref Sequence ENSEMBL: ENSMUSP00000154298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078186] [ENSMUST00000227706] [ENSMUST00000228690]
AlphaFold Q8R2C2
Predicted Effect probably benign
Transcript: ENSMUST00000078186
AA Change: Q208L

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093561
Gene: ENSMUSG00000061208
AA Change: Q208L

DomainStartEndE-ValueType
Pfam:V1R 28 293 1.2e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227706
AA Change: Q208L

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000228690
AA Change: Q208L

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (92/94)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T A 10: 70,868,800 noncoding transcript Het
4931409K22Rik C T 5: 24,549,762 V337M possibly damaging Het
Alox5 A G 6: 116,423,330 probably benign Het
Anxa11 T A 14: 25,873,997 D203E probably damaging Het
Atp12a A T 14: 56,374,481 N371Y probably damaging Het
Bloc1s6 A G 2: 122,742,623 I39M probably benign Het
Celsr3 A C 9: 108,834,655 I1688L possibly damaging Het
Cgn T C 3: 94,774,894 probably benign Het
Chd4 A T 6: 125,102,967 I453F probably damaging Het
Dbnl A G 11: 5,797,321 T247A probably benign Het
Dpysl3 T C 18: 43,438,071 E46G possibly damaging Het
Dsg1a T C 18: 20,335,892 probably benign Het
Fbp1 C T 13: 62,871,285 E150K probably benign Het
Flnb T A 14: 7,927,352 L1854Q probably damaging Het
Gcn1l1 C T 5: 115,589,303 T714M probably benign Het
Gm12216 A T 11: 53,813,336 probably benign Het
Gpr82 T C X: 13,665,590 S126P probably benign Het
Hmbs T A 9: 44,337,360 H256L probably benign Het
Ibsp A T 5: 104,310,020 probably null Het
Ints13 A G 6: 146,552,461 V240A probably benign Het
Kalrn T C 16: 34,032,467 D343G probably damaging Het
Kin T C 2: 10,085,720 probably benign Het
Klhdc1 T C 12: 69,258,030 V192A probably benign Het
Lpar3 T A 3: 146,240,671 C35S possibly damaging Het
Lrrtm4 A G 6: 80,021,970 I122V possibly damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mgat4c T C 10: 102,388,591 M222T probably damaging Het
Muc4 C A 16: 32,751,670 S516Y possibly damaging Het
Myo1e A T 9: 70,367,674 Q703L probably damaging Het
Neb A G 2: 52,225,558 probably benign Het
Necab3 T G 2: 154,546,303 E239A probably null Het
Npr1 G T 3: 90,461,369 N461K probably benign Het
Olfr1294 T C 2: 111,537,627 I221V probably damaging Het
Pcdhb2 A G 18: 37,295,490 Y172C probably damaging Het
Pcdhb7 A G 18: 37,341,901 D30G probably benign Het
Phf12 A C 11: 78,029,332 Q898P probably benign Het
Plekhn1 T C 4: 156,225,364 E132G possibly damaging Het
Ptpn3 A G 4: 57,270,075 V29A probably benign Het
Rundc3b T A 5: 8,569,529 I143F probably damaging Het
Ryr3 T G 2: 112,648,306 probably benign Het
Sash1 A G 10: 8,751,137 probably null Het
Slc4a2 A G 5: 24,431,259 D201G probably benign Het
Tecpr1 T A 5: 144,214,053 probably null Het
Timm21 T C 18: 84,949,201 H150R probably damaging Het
Tmem79 T C 3: 88,332,934 T236A probably damaging Het
Usp34 G T 11: 23,472,967 V3095F probably damaging Het
Other mutations in Vmn1r8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Vmn1r8 APN 6 57036287 missense possibly damaging 0.70
IGL01820:Vmn1r8 APN 6 57036668 missense possibly damaging 0.94
IGL02416:Vmn1r8 APN 6 57036620 missense probably damaging 0.97
IGL02496:Vmn1r8 APN 6 57036571 missense probably damaging 1.00
IGL02930:Vmn1r8 APN 6 57036594 missense probably benign 0.03
IGL02954:Vmn1r8 APN 6 57036330 missense probably benign 0.03
IGL03235:Vmn1r8 APN 6 57036761 nonsense probably null
IGL03353:Vmn1r8 APN 6 57036791 missense probably benign 0.03
PIT4494001:Vmn1r8 UTSW 6 57036727 missense probably benign 0.01
R1328:Vmn1r8 UTSW 6 57036293 missense possibly damaging 0.94
R1846:Vmn1r8 UTSW 6 57036428 missense probably benign 0.06
R2083:Vmn1r8 UTSW 6 57036340 missense probably benign 0.21
R3683:Vmn1r8 UTSW 6 57036275 missense probably damaging 1.00
R4134:Vmn1r8 UTSW 6 57036720 missense probably benign
R4754:Vmn1r8 UTSW 6 57035967 start codon destroyed probably null 1.00
R4857:Vmn1r8 UTSW 6 57036353 missense probably benign 0.00
R5787:Vmn1r8 UTSW 6 57036259 missense probably damaging 1.00
R6158:Vmn1r8 UTSW 6 57036289 missense probably benign 0.00
R6711:Vmn1r8 UTSW 6 57036459 missense probably damaging 1.00
R6971:Vmn1r8 UTSW 6 57036415 missense probably damaging 1.00
R8066:Vmn1r8 UTSW 6 57036434 missense probably benign 0.03
R8261:Vmn1r8 UTSW 6 57036173 missense probably benign 0.00
R8526:Vmn1r8 UTSW 6 57036377 missense probably benign 0.05
R8552:Vmn1r8 UTSW 6 57036153 missense possibly damaging 0.76
R8692:Vmn1r8 UTSW 6 57036572 missense probably benign 0.01
R8712:Vmn1r8 UTSW 6 57036680 missense probably benign 0.07
R9306:Vmn1r8 UTSW 6 57036728 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GCAGGTCACTAAATCCTGCTCACTC -3'
(R):5'- ACAGCACACACTGGTAATGAACGAG -3'

Sequencing Primer
(F):5'- TGCTCACTCTTACCCATGAAC -3'
(R):5'- CTGATTTGTACCAAAGGGGTAACTG -3'
Posted On 2014-09-17