Incidental Mutation 'R0656:Sash1'
ID 226147
Institutional Source Beutler Lab
Gene Symbol Sash1
Ensembl Gene ENSMUSG00000015305
Gene Name SAM and SH3 domain containing 1
Synonyms A330076K04Rik, 2500002E12Rik, 1100001C18Rik
MMRRC Submission 038841-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0656 (G1)
Quality Score 69
Status Validated
Chromosome 10
Chromosomal Location 8597983-8761814 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 8626901 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000015449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015449] [ENSMUST00000212553] [ENSMUST00000212869]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000015449
SMART Domains Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
coiled coil region 185 212 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
Pfam:SLY 394 548 1.2e-46 PFAM
SH3 550 607 1.16e-3 SMART
SAM 623 690 1.83e-11 SMART
low complexity region 1008 1021 N/A INTRINSIC
SAM 1157 1224 3.6e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212553
Predicted Effect possibly damaging
Transcript: ENSMUST00000212869
AA Change: V161A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T A 10: 70,704,630 (GRCm39) noncoding transcript Het
Alox5 A G 6: 116,400,291 (GRCm39) probably benign Het
Anxa11 T A 14: 25,874,421 (GRCm39) D203E probably damaging Het
Atp12a A T 14: 56,611,938 (GRCm39) N371Y probably damaging Het
Bloc1s6 A G 2: 122,584,543 (GRCm39) I39M probably benign Het
Celsr3 A C 9: 108,711,854 (GRCm39) I1688L possibly damaging Het
Cgn T C 3: 94,682,204 (GRCm39) probably benign Het
Chd4 A T 6: 125,079,930 (GRCm39) I453F probably damaging Het
Dbnl A G 11: 5,747,321 (GRCm39) T247A probably benign Het
Dpysl3 T C 18: 43,571,136 (GRCm39) E46G possibly damaging Het
Dsg1a T C 18: 20,468,949 (GRCm39) probably benign Het
Fbp1 C T 13: 63,019,099 (GRCm39) E150K probably benign Het
Flnb T A 14: 7,927,352 (GRCm38) L1854Q probably damaging Het
Gcn1 C T 5: 115,727,362 (GRCm39) T714M probably benign Het
Gm12216 A T 11: 53,704,162 (GRCm39) probably benign Het
Gpr82 T C X: 13,531,829 (GRCm39) S126P probably benign Het
Hmbs T A 9: 44,248,657 (GRCm39) H256L probably benign Het
Ibsp A T 5: 104,457,886 (GRCm39) probably null Het
Ints13 A G 6: 146,453,959 (GRCm39) V240A probably benign Het
Iqca1l C T 5: 24,754,760 (GRCm39) V337M possibly damaging Het
Kalrn T C 16: 33,852,837 (GRCm39) D343G probably damaging Het
Kin T C 2: 10,090,531 (GRCm39) probably benign Het
Klhdc1 T C 12: 69,304,804 (GRCm39) V192A probably benign Het
Lpar3 T A 3: 145,946,426 (GRCm39) C35S possibly damaging Het
Lrrtm4 A G 6: 79,998,953 (GRCm39) I122V possibly damaging Het
Mfsd13a C T 19: 46,354,943 (GRCm39) T40I probably benign Het
Mgat4c T C 10: 102,224,452 (GRCm39) M222T probably damaging Het
Muc4 C A 16: 32,570,488 (GRCm39) S516Y possibly damaging Het
Myo1e A T 9: 70,274,956 (GRCm39) Q703L probably damaging Het
Neb A G 2: 52,115,570 (GRCm39) probably benign Het
Necab3 T G 2: 154,388,223 (GRCm39) E239A probably null Het
Npr1 G T 3: 90,368,676 (GRCm39) N461K probably benign Het
Or4k44 T C 2: 111,367,972 (GRCm39) I221V probably damaging Het
Pcdhb2 A G 18: 37,428,543 (GRCm39) Y172C probably damaging Het
Pcdhb7 A G 18: 37,474,954 (GRCm39) D30G probably benign Het
Phf12 A C 11: 77,920,158 (GRCm39) Q898P probably benign Het
Plekhn1 T C 4: 156,309,821 (GRCm39) E132G possibly damaging Het
Ptpn3 A G 4: 57,270,075 (GRCm39) V29A probably benign Het
Rundc3b T A 5: 8,619,529 (GRCm39) I143F probably damaging Het
Ryr3 T G 2: 112,478,651 (GRCm39) probably benign Het
Slc4a2 A G 5: 24,636,257 (GRCm39) D201G probably benign Het
Tecpr1 T A 5: 144,150,871 (GRCm39) probably null Het
Timm21 T C 18: 84,967,326 (GRCm39) H150R probably damaging Het
Tmem79 T C 3: 88,240,241 (GRCm39) T236A probably damaging Het
Usp34 G T 11: 23,422,967 (GRCm39) V3095F probably damaging Het
Vmn1r8 A T 6: 57,013,573 (GRCm39) Q208L probably benign Het
Other mutations in Sash1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Sash1 APN 10 8,627,177 (GRCm39) missense probably damaging 1.00
IGL01535:Sash1 APN 10 8,617,341 (GRCm39) missense probably damaging 1.00
IGL01537:Sash1 APN 10 8,605,422 (GRCm39) missense probably damaging 1.00
IGL01788:Sash1 APN 10 8,609,410 (GRCm39) missense probably benign 0.01
IGL01933:Sash1 APN 10 8,626,897 (GRCm39) missense probably damaging 0.99
IGL02126:Sash1 APN 10 8,615,229 (GRCm39) missense probably damaging 0.96
IGL02285:Sash1 APN 10 8,616,098 (GRCm39) missense probably damaging 0.99
IGL02400:Sash1 APN 10 8,609,411 (GRCm39) nonsense probably null
IGL02504:Sash1 APN 10 8,605,676 (GRCm39) missense probably benign 0.00
IGL02630:Sash1 APN 10 8,620,299 (GRCm39) missense probably benign 0.06
boyscout UTSW 10 8,618,186 (GRCm39) splice site probably null
cubscout UTSW 10 8,605,477 (GRCm39) missense probably benign 0.01
R0592:Sash1 UTSW 10 8,605,546 (GRCm39) missense probably benign 0.00
R0647:Sash1 UTSW 10 8,605,316 (GRCm39) missense probably damaging 0.99
R0830:Sash1 UTSW 10 8,605,673 (GRCm39) missense probably benign 0.01
R0919:Sash1 UTSW 10 8,605,843 (GRCm39) missense probably benign 0.01
R1470:Sash1 UTSW 10 8,665,357 (GRCm39) missense probably damaging 1.00
R1470:Sash1 UTSW 10 8,665,357 (GRCm39) missense probably damaging 1.00
R1606:Sash1 UTSW 10 8,605,721 (GRCm39) missense probably benign 0.00
R1707:Sash1 UTSW 10 8,606,141 (GRCm39) missense probably benign 0.00
R1922:Sash1 UTSW 10 8,603,672 (GRCm39) missense possibly damaging 0.62
R1940:Sash1 UTSW 10 8,605,696 (GRCm39) missense probably benign
R1964:Sash1 UTSW 10 8,605,477 (GRCm39) missense probably benign 0.01
R2013:Sash1 UTSW 10 8,605,177 (GRCm39) missense probably benign 0.03
R2014:Sash1 UTSW 10 8,605,177 (GRCm39) missense probably benign 0.03
R2015:Sash1 UTSW 10 8,605,177 (GRCm39) missense probably benign 0.03
R2074:Sash1 UTSW 10 8,632,461 (GRCm39) missense probably damaging 1.00
R2252:Sash1 UTSW 10 8,605,741 (GRCm39) missense probably benign 0.01
R2253:Sash1 UTSW 10 8,605,741 (GRCm39) missense probably benign 0.01
R2260:Sash1 UTSW 10 8,662,142 (GRCm39) nonsense probably null
R3085:Sash1 UTSW 10 8,618,186 (GRCm39) splice site probably null
R4024:Sash1 UTSW 10 8,605,681 (GRCm39) missense probably benign 0.00
R4039:Sash1 UTSW 10 8,605,391 (GRCm39) missense probably damaging 1.00
R4290:Sash1 UTSW 10 8,606,006 (GRCm39) missense possibly damaging 0.59
R4292:Sash1 UTSW 10 8,606,006 (GRCm39) missense possibly damaging 0.59
R4295:Sash1 UTSW 10 8,606,006 (GRCm39) missense possibly damaging 0.59
R4301:Sash1 UTSW 10 8,627,234 (GRCm39) missense probably benign 0.00
R4657:Sash1 UTSW 10 8,601,424 (GRCm39) missense probably damaging 1.00
R4669:Sash1 UTSW 10 8,606,149 (GRCm39) missense probably benign 0.00
R4719:Sash1 UTSW 10 8,605,477 (GRCm39) missense probably benign 0.01
R4745:Sash1 UTSW 10 8,605,672 (GRCm39) missense probably benign
R5197:Sash1 UTSW 10 8,615,989 (GRCm39) missense probably damaging 1.00
R5217:Sash1 UTSW 10 8,656,368 (GRCm39) missense possibly damaging 0.63
R5420:Sash1 UTSW 10 8,621,950 (GRCm39) missense probably damaging 1.00
R5591:Sash1 UTSW 10 8,601,482 (GRCm39) missense probably benign 0.36
R6505:Sash1 UTSW 10 8,605,291 (GRCm39) missense probably benign 0.21
R6679:Sash1 UTSW 10 8,615,949 (GRCm39) missense probably damaging 1.00
R6761:Sash1 UTSW 10 8,620,286 (GRCm39) missense probably damaging 0.99
R6885:Sash1 UTSW 10 8,659,985 (GRCm39) missense probably damaging 1.00
R6980:Sash1 UTSW 10 8,605,612 (GRCm39) missense probably benign 0.00
R7034:Sash1 UTSW 10 8,605,847 (GRCm39) nonsense probably null
R7036:Sash1 UTSW 10 8,605,847 (GRCm39) nonsense probably null
R7088:Sash1 UTSW 10 8,605,481 (GRCm39) nonsense probably null
R7289:Sash1 UTSW 10 8,605,960 (GRCm39) missense probably damaging 0.99
R7464:Sash1 UTSW 10 8,632,509 (GRCm39) missense possibly damaging 0.82
R7661:Sash1 UTSW 10 8,605,155 (GRCm39) missense probably benign 0.01
R7752:Sash1 UTSW 10 8,656,328 (GRCm39) nonsense probably null
R7856:Sash1 UTSW 10 8,605,472 (GRCm39) missense probably benign 0.00
R7901:Sash1 UTSW 10 8,656,328 (GRCm39) nonsense probably null
R8152:Sash1 UTSW 10 8,626,805 (GRCm39) missense possibly damaging 0.94
R8218:Sash1 UTSW 10 8,627,000 (GRCm39) missense probably damaging 0.99
R8317:Sash1 UTSW 10 8,605,150 (GRCm39) missense possibly damaging 0.76
R8358:Sash1 UTSW 10 8,605,745 (GRCm39) missense probably benign
R8503:Sash1 UTSW 10 8,656,277 (GRCm39) splice site probably benign
R8696:Sash1 UTSW 10 8,609,459 (GRCm39) missense probably damaging 1.00
R8703:Sash1 UTSW 10 8,605,595 (GRCm39) missense probably damaging 0.99
R8710:Sash1 UTSW 10 8,656,285 (GRCm39) missense possibly damaging 0.82
R8822:Sash1 UTSW 10 8,761,615 (GRCm39) start gained probably benign
R8826:Sash1 UTSW 10 8,637,869 (GRCm39) start codon destroyed probably null
R8891:Sash1 UTSW 10 8,603,734 (GRCm39) missense probably damaging 1.00
R8968:Sash1 UTSW 10 8,606,179 (GRCm39) missense probably benign 0.00
R8984:Sash1 UTSW 10 8,626,808 (GRCm39) missense possibly damaging 0.46
R9194:Sash1 UTSW 10 8,615,969 (GRCm39) missense probably damaging 0.99
R9248:Sash1 UTSW 10 8,617,296 (GRCm39) missense probably damaging 1.00
R9405:Sash1 UTSW 10 8,637,994 (GRCm39) start gained probably benign
R9408:Sash1 UTSW 10 8,637,994 (GRCm39) start gained probably benign
R9489:Sash1 UTSW 10 8,605,169 (GRCm39) missense probably benign 0.05
R9576:Sash1 UTSW 10 8,620,299 (GRCm39) missense probably benign 0.06
R9632:Sash1 UTSW 10 8,615,969 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCACAGGTGCTGCCATTTACTC -3'
(R):5'- AGATGATGCAGACTCTCTCACCCC -3'

Sequencing Primer
(F):5'- GGTGCTGCCATTTACTCCTTTTC -3'
(R):5'- AGCAGCCTGGATACGTGG -3'
Posted On 2014-09-17