Mutagenetix > Incidental Mutations

Incidental Mutation 'R0656:Sash1'

226147

Institutional Source

Beutler Lab

Gene Symbol

Sash1

Ensembl Gene

ENSMUSG00000015305

Gene Name

SAM and SH3 domain containing 1

Synonyms

MMRRC Submission

038841-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0656 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

8722219-8886070 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 8751137 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000015449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015449] [ENSMUST00000212553] [ENSMUST00000212869]

Predicted Effect

probably null
Transcript: ENSMUST00000015449

SMART Domains

Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
coiled coil region	185	212	N/A	INTRINSIC
low complexity region	323	336	N/A	INTRINSIC
Pfam:SLY	394	548	1.2e-46	PFAM
SH3	550	607	1.16e-3	SMART
SAM	623	690	1.83e-11	SMART
low complexity region	1008	1021	N/A	INTRINSIC
SAM	1157	1224	3.6e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000212553

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212869
AA Change: V161A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)

Meta Mutation Damage Score

0.9491

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.2%

Validation Efficiency

98% (92/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930533K18Rik	T	A	10: 70,868,800		noncoding transcript	Het
4931409K22Rik	C	T	5: 24,549,762	V337M	possibly damaging	Het
Alox5	A	G	6: 116,423,330		probably benign	Het
Anxa11	T	A	14: 25,873,997	D203E	probably damaging	Het
Atp12a	A	T	14: 56,374,481	N371Y	probably damaging	Het
Bloc1s6	A	G	2: 122,742,623	I39M	probably benign	Het
Celsr3	A	C	9: 108,834,655	I1688L	possibly damaging	Het
Cgn	T	C	3: 94,774,894		probably benign	Het
Chd4	A	T	6: 125,102,967	I453F	probably damaging	Het
Dbnl	A	G	11: 5,797,321	T247A	probably benign	Het
Dpysl3	T	C	18: 43,438,071	E46G	possibly damaging	Het
Dsg1a	T	C	18: 20,335,892		probably benign	Het
Fbp1	C	T	13: 62,871,285	E150K	probably benign	Het
Flnb	T	A	14: 7,927,352	L1854Q	probably damaging	Het
Gcn1l1	C	T	5: 115,589,303	T714M	probably benign	Het
Gm12216	A	T	11: 53,813,336		probably benign	Het
Gpr82	T	C	X: 13,665,590	S126P	probably benign	Het
Hmbs	T	A	9: 44,337,360	H256L	probably benign	Het
Ibsp	A	T	5: 104,310,020		probably null	Het
Ints13	A	G	6: 146,552,461	V240A	probably benign	Het
Kalrn	T	C	16: 34,032,467	D343G	probably damaging	Het
Kin	T	C	2: 10,085,720		probably benign	Het
Klhdc1	T	C	12: 69,258,030	V192A	probably benign	Het
Lpar3	T	A	3: 146,240,671	C35S	possibly damaging	Het
Lrrtm4	A	G	6: 80,021,970	I122V	possibly damaging	Het
Mfsd13a	C	T	19: 46,366,504	T40I	probably benign	Het
Mgat4c	T	C	10: 102,388,591	M222T	probably damaging	Het
Muc4	C	A	16: 32,751,670	S516Y	possibly damaging	Het
Myo1e	A	T	9: 70,367,674	Q703L	probably damaging	Het
Neb	A	G	2: 52,225,558		probably benign	Het
Necab3	T	G	2: 154,546,303	E239A	probably null	Het
Npr1	G	T	3: 90,461,369	N461K	probably benign	Het
Olfr1294	T	C	2: 111,537,627	I221V	probably damaging	Het
Pcdhb2	A	G	18: 37,295,490	Y172C	probably damaging	Het
Pcdhb7	A	G	18: 37,341,901	D30G	probably benign	Het
Phf12	A	C	11: 78,029,332	Q898P	probably benign	Het
Plekhn1	T	C	4: 156,225,364	E132G	possibly damaging	Het
Ptpn3	A	G	4: 57,270,075	V29A	probably benign	Het
Rundc3b	T	A	5: 8,569,529	I143F	probably damaging	Het
Ryr3	T	G	2: 112,648,306		probably benign	Het
Slc4a2	A	G	5: 24,431,259	D201G	probably benign	Het
Tecpr1	T	A	5: 144,214,053		probably null	Het
Timm21	T	C	18: 84,949,201	H150R	probably damaging	Het
Tmem79	T	C	3: 88,332,934	T236A	probably damaging	Het
Usp34	G	T	11: 23,472,967	V3095F	probably damaging	Het
Vmn1r8	A	T	6: 57,036,588	Q208L	probably benign	Het

Other mutations in Sash1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00987:Sash1	APN	10	8751413	missense	probably damaging	1.00
IGL01535:Sash1	APN	10	8741577	missense	probably damaging	1.00
IGL01537:Sash1	APN	10	8729658	missense	probably damaging	1.00
IGL01788:Sash1	APN	10	8733646	missense	probably benign	0.01
IGL01933:Sash1	APN	10	8751133	missense	probably damaging	0.99
IGL02126:Sash1	APN	10	8739465	missense	probably damaging	0.96
IGL02285:Sash1	APN	10	8740334	missense	probably damaging	0.99
IGL02400:Sash1	APN	10	8733647	nonsense	probably null
IGL02504:Sash1	APN	10	8729912	missense	probably benign	0.00
IGL02630:Sash1	APN	10	8744535	missense	probably benign	0.06
boyscout	UTSW	10	8742422	splice site	probably null
cubscout	UTSW	10	8729713	missense	probably benign	0.01
R0592:Sash1	UTSW	10	8729782	missense	probably benign	0.00
R0647:Sash1	UTSW	10	8729552	missense	probably damaging	0.99
R0830:Sash1	UTSW	10	8729909	missense	probably benign	0.01
R0919:Sash1	UTSW	10	8730079	missense	probably benign	0.01
R1470:Sash1	UTSW	10	8789593	missense	probably damaging	1.00
R1470:Sash1	UTSW	10	8789593	missense	probably damaging	1.00
R1606:Sash1	UTSW	10	8729957	missense	probably benign	0.00
R1707:Sash1	UTSW	10	8730377	missense	probably benign	0.00
R1922:Sash1	UTSW	10	8727908	missense	possibly damaging	0.62
R1940:Sash1	UTSW	10	8729932	missense	probably benign
R1964:Sash1	UTSW	10	8729713	missense	probably benign	0.01
R2013:Sash1	UTSW	10	8729413	missense	probably benign	0.03
R2014:Sash1	UTSW	10	8729413	missense	probably benign	0.03
R2015:Sash1	UTSW	10	8729413	missense	probably benign	0.03
R2074:Sash1	UTSW	10	8756697	missense	probably damaging	1.00
R2252:Sash1	UTSW	10	8729977	missense	probably benign	0.01
R2253:Sash1	UTSW	10	8729977	missense	probably benign	0.01
R2260:Sash1	UTSW	10	8786378	nonsense	probably null
R3085:Sash1	UTSW	10	8742422	splice site	probably null
R4024:Sash1	UTSW	10	8729917	missense	probably benign	0.00
R4039:Sash1	UTSW	10	8729627	missense	probably damaging	1.00
R4290:Sash1	UTSW	10	8730242	missense	possibly damaging	0.59
R4292:Sash1	UTSW	10	8730242	missense	possibly damaging	0.59
R4295:Sash1	UTSW	10	8730242	missense	possibly damaging	0.59
R4301:Sash1	UTSW	10	8751470	missense	probably benign	0.00
R4657:Sash1	UTSW	10	8725660	missense	probably damaging	1.00
R4669:Sash1	UTSW	10	8730385	missense	probably benign	0.00
R4719:Sash1	UTSW	10	8729713	missense	probably benign	0.01
R4745:Sash1	UTSW	10	8729908	missense	probably benign
R5197:Sash1	UTSW	10	8740225	missense	probably damaging	1.00
R5217:Sash1	UTSW	10	8780604	missense	possibly damaging	0.63
R5420:Sash1	UTSW	10	8746186	missense	probably damaging	1.00
R5591:Sash1	UTSW	10	8725718	missense	probably benign	0.36
R6505:Sash1	UTSW	10	8729527	missense	probably benign	0.21
R6679:Sash1	UTSW	10	8740185	missense	probably damaging	1.00
R6761:Sash1	UTSW	10	8744522	missense	probably damaging	0.99
R6885:Sash1	UTSW	10	8784221	missense	probably damaging	1.00
R6980:Sash1	UTSW	10	8729848	missense	probably benign	0.00
R7034:Sash1	UTSW	10	8730083	nonsense	probably null
R7036:Sash1	UTSW	10	8730083	nonsense	probably null
R7088:Sash1	UTSW	10	8729717	nonsense	probably null
R7289:Sash1	UTSW	10	8730196	missense	probably damaging	0.99
R7464:Sash1	UTSW	10	8756745	missense	possibly damaging	0.82
R7661:Sash1	UTSW	10	8729391	missense	probably benign	0.01
R7752:Sash1	UTSW	10	8780564	nonsense	probably null
R7856:Sash1	UTSW	10	8729708	missense	probably benign	0.00
R7901:Sash1	UTSW	10	8780564	nonsense	probably null
R8152:Sash1	UTSW	10	8751041	missense	possibly damaging	0.94
R8218:Sash1	UTSW	10	8751236	missense	probably damaging	0.99
R8317:Sash1	UTSW	10	8729386	missense	possibly damaging	0.76
R8358:Sash1	UTSW	10	8729981	missense	probably benign
R8503:Sash1	UTSW	10	8780513	splice site	probably benign

Predicted Primers

PCR Primer
(F):5'- GGTCACAGGTGCTGCCATTTACTC -3'
(R):5'- AGATGATGCAGACTCTCTCACCCC -3'

Sequencing Primer
(F):5'- GGTGCTGCCATTTACTCCTTTTC -3'
(R):5'- AGCAGCCTGGATACGTGG -3'

Posted On

2014-09-17