Incidental Mutation 'R0147:Plxna1'
ID22616
Institutional Source Beutler Lab
Gene Symbol Plxna1
Ensembl Gene ENSMUSG00000030084
Gene Nameplexin A1
SynonymsNOV, Plxn1, PlexA1, 2600013D04Rik
MMRRC Submission 038431-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R0147 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location89316314-89362620 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89320710 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1831 (A1831T)
Ref Sequence ENSEMBL: ENSMUSP00000131840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049845] [ENSMUST00000163139]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049845
AA Change: A1831T

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084
AA Change: A1831T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1316 1864 8.8e-263 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163139
AA Change: A1831T

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084
AA Change: A1831T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1315 1864 2.5e-264 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181258
Predicted Effect probably benign
Transcript: ENSMUST00000204468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205230
Meta Mutation Damage Score 0.1735 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.1%
Validation Efficiency 67% (88/131)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit bone cellularity abnormalities, altered dendritic cell physiology, abnormal proprioceptive and oligodendrocyte morphology, and increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,189,271 R594C probably damaging Het
A2m T C 6: 121,662,446 probably null Het
Abtb2 A G 2: 103,567,135 I137V probably benign Het
Ank1 T A 8: 23,123,977 N1545K probably damaging Het
Arl6 T C 16: 59,618,790 probably benign Het
Avl9 T A 6: 56,736,502 D248E probably benign Het
Becn1 T C 11: 101,301,736 E40G probably damaging Het
Bod1l G T 5: 41,818,697 A1758E possibly damaging Het
Btbd16 C T 7: 130,779,594 T19I probably damaging Het
Casc3 T A 11: 98,822,499 N246K possibly damaging Het
Celf1 G T 2: 91,004,690 probably benign Het
Chrm3 G T 13: 9,878,744 N85K probably damaging Het
Cluh T A 11: 74,665,938 Y935N probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col6a5 T C 9: 105,925,794 D1324G unknown Het
Ctcfl T C 2: 173,118,547 D81G possibly damaging Het
D630003M21Rik C T 2: 158,203,067 probably benign Het
Ddx39 C T 8: 83,722,476 R298C possibly damaging Het
Dnmt3b T G 2: 153,661,457 N9K possibly damaging Het
Dock8 T C 19: 25,119,459 L577P probably benign Het
Drc1 A T 5: 30,281,489 N13I possibly damaging Het
Eml4 T A 17: 83,421,652 N85K probably damaging Het
Epb41l4a T C 18: 33,798,800 T581A probably damaging Het
Epha3 T C 16: 63,612,944 D446G possibly damaging Het
Fam208a A G 14: 27,471,768 D975G probably benign Het
Fam209 G T 2: 172,473,980 G92C probably damaging Het
Fam98c T A 7: 29,152,721 R340* probably null Het
Fbxw10 T G 11: 62,847,481 probably null Het
Galr1 A G 18: 82,405,570 L194P probably benign Het
Gar1 T C 3: 129,829,473 H89R probably damaging Het
Gbp4 T A 5: 105,119,496 Y519F probably benign Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Grid2 T C 6: 64,533,587 Y734H probably benign Het
Grm6 T A 11: 50,859,317 I466N possibly damaging Het
Hectd3 T C 4: 116,997,040 probably benign Het
Hpse2 A C 19: 42,931,660 probably null Het
Hspb7 T C 4: 141,423,991 I148T probably damaging Het
Htr1d C A 4: 136,443,477 T339K probably damaging Het
Ip6k1 T A 9: 108,045,894 D408E probably damaging Het
Irs2 A T 8: 11,007,568 M288K probably damaging Het
Kansl3 A T 1: 36,353,816 C225S probably damaging Het
Knop1 C A 7: 118,845,838 R301L probably benign Het
Lama5 T C 2: 180,190,406 H1714R probably benign Het
Mettl14 G A 3: 123,371,394 T316I probably damaging Het
Mmp15 A T 8: 95,372,317 N591Y probably benign Het
Mprip T A 11: 59,737,073 D93E possibly damaging Het
Mtmr14 T A 6: 113,260,666 probably benign Het
Muc5ac T C 7: 141,811,039 S1917P probably benign Het
Muc6 C T 7: 141,651,990 C75Y probably damaging Het
Naip1 A T 13: 100,426,910 H582Q possibly damaging Het
Nbeal2 G A 9: 110,642,143 R264* probably null Het
Neb T C 2: 52,249,376 K140E probably damaging Het
Nfya A G 17: 48,398,998 V48A possibly damaging Het
Ngf G T 3: 102,509,803 probably benign Het
Nsmce2 T G 15: 59,378,957 S26A probably damaging Het
Olfr1026 T A 2: 85,924,018 I250N possibly damaging Het
Olfr601 T C 7: 103,358,406 T263A possibly damaging Het
Olfr873 T G 9: 20,301,091 M297R probably damaging Het
Pax1 A G 2: 147,373,734 S424G probably benign Het
Pcdhb19 A T 18: 37,497,182 Q10L probably benign Het
Pdcl T C 2: 37,352,130 I203V probably benign Het
Pknox1 T A 17: 31,604,790 N379K probably benign Het
Prodh T G 16: 18,077,813 Q360P probably damaging Het
Pygo2 T C 3: 89,433,303 V299A probably damaging Het
Raf1 C T 6: 115,632,973 G202S probably benign Het
Rgs11 T A 17: 26,207,459 probably null Het
Rnf13 A G 3: 57,802,468 D144G probably damaging Het
Rtel1 T C 2: 181,321,046 C31R probably damaging Het
Rubcnl T A 14: 75,042,458 I427K probably damaging Het
Sec23ip C T 7: 128,779,051 probably benign Het
Slc25a26 T A 6: 94,592,526 probably null Het
Slc6a7 A G 18: 61,002,111 probably benign Het
Slco6b1 A T 1: 96,987,837 noncoding transcript Het
Spata17 A G 1: 187,112,601 V111A probably damaging Het
Spata22 T A 11: 73,331,153 M1K probably null Het
Svep1 C T 4: 58,116,608 D881N possibly damaging Het
Sypl2 T A 3: 108,219,095 N67I possibly damaging Het
Tenm3 T C 8: 48,236,720 Y1944C probably damaging Het
Tm9sf4 G T 2: 153,195,313 V365L probably benign Het
Tmc3 T C 7: 83,607,742 V401A probably damaging Het
Trpm2 C T 10: 77,925,825 G997D probably damaging Het
Unc5b A T 10: 60,772,297 S675T probably damaging Het
Vmn1r217 A G 13: 23,113,937 M265T probably benign Het
Vps54 T A 11: 21,300,259 D548E probably benign Het
Wdfy3 A G 5: 101,917,411 V1297A probably benign Het
Wdr46 T A 17: 33,941,023 F70I probably benign Het
Zdbf2 C T 1: 63,304,006 Q515* probably null Het
Zfp710 T A 7: 80,081,973 C299* probably null Het
Other mutations in Plxna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Plxna1 APN 6 89320998 missense probably damaging 1.00
IGL01358:Plxna1 APN 6 89322750 missense probably damaging 1.00
IGL01475:Plxna1 APN 6 89354888 missense possibly damaging 0.92
IGL01480:Plxna1 APN 6 89344096 missense possibly damaging 0.70
IGL01585:Plxna1 APN 6 89329556 critical splice donor site probably null
IGL01804:Plxna1 APN 6 89329646 missense probably damaging 1.00
IGL01909:Plxna1 APN 6 89332084 critical splice donor site probably null
IGL01989:Plxna1 APN 6 89329414 nonsense probably null
IGL02015:Plxna1 APN 6 89342451 missense probably damaging 1.00
IGL02023:Plxna1 APN 6 89357332 missense possibly damaging 0.88
IGL02668:Plxna1 APN 6 89357269 nonsense probably null
IGL02703:Plxna1 APN 6 89356943 missense probably damaging 1.00
IGL02954:Plxna1 APN 6 89324667 missense probably damaging 1.00
IGL03212:Plxna1 APN 6 89331903 missense probably damaging 1.00
PIT4544001:Plxna1 UTSW 6 89357429 missense probably benign 0.14
R0055:Plxna1 UTSW 6 89329739 missense possibly damaging 0.94
R0055:Plxna1 UTSW 6 89329739 missense possibly damaging 0.94
R0149:Plxna1 UTSW 6 89320613 missense probably null 0.95
R0166:Plxna1 UTSW 6 89333019 missense probably damaging 1.00
R0200:Plxna1 UTSW 6 89323593 missense probably damaging 1.00
R0415:Plxna1 UTSW 6 89357336 missense probably benign 0.12
R0841:Plxna1 UTSW 6 89332204 missense probably damaging 1.00
R1018:Plxna1 UTSW 6 89342960 missense probably damaging 1.00
R1240:Plxna1 UTSW 6 89321050 missense probably damaging 1.00
R1355:Plxna1 UTSW 6 89320766 unclassified probably benign
R1700:Plxna1 UTSW 6 89357008 missense probably damaging 1.00
R1776:Plxna1 UTSW 6 89335464 missense probably benign 0.00
R1957:Plxna1 UTSW 6 89331291 missense probably damaging 1.00
R2314:Plxna1 UTSW 6 89324316 missense probably damaging 1.00
R2968:Plxna1 UTSW 6 89342608 missense probably damaging 1.00
R3118:Plxna1 UTSW 6 89356976 missense possibly damaging 0.89
R3522:Plxna1 UTSW 6 89337353 critical splice acceptor site probably null
R3619:Plxna1 UTSW 6 89357453 missense probably damaging 0.97
R3766:Plxna1 UTSW 6 89334775 unclassified probably benign
R3847:Plxna1 UTSW 6 89356519 missense probably damaging 1.00
R3849:Plxna1 UTSW 6 89356519 missense probably damaging 1.00
R3872:Plxna1 UTSW 6 89332692 nonsense probably null
R4555:Plxna1 UTSW 6 89323328 missense probably damaging 0.99
R4709:Plxna1 UTSW 6 89334751 missense possibly damaging 0.72
R4726:Plxna1 UTSW 6 89322816 missense probably damaging 1.00
R4739:Plxna1 UTSW 6 89332675 splice site probably null
R5053:Plxna1 UTSW 6 89322460 missense probably damaging 1.00
R5221:Plxna1 UTSW 6 89321016 missense probably damaging 1.00
R5449:Plxna1 UTSW 6 89323608 missense probably damaging 1.00
R5480:Plxna1 UTSW 6 89324634 missense probably damaging 1.00
R5575:Plxna1 UTSW 6 89324541 missense possibly damaging 0.83
R5743:Plxna1 UTSW 6 89356529 missense probably damaging 1.00
R5744:Plxna1 UTSW 6 89334682 missense possibly damaging 0.67
R5754:Plxna1 UTSW 6 89333105 missense possibly damaging 0.96
R5868:Plxna1 UTSW 6 89322722 splice site probably benign
R5988:Plxna1 UTSW 6 89357540 nonsense probably null
R6190:Plxna1 UTSW 6 89356604 nonsense probably null
R6425:Plxna1 UTSW 6 89334665 missense probably benign 0.00
R6561:Plxna1 UTSW 6 89356978 missense probably damaging 1.00
R6623:Plxna1 UTSW 6 89322771 missense probably damaging 1.00
R6638:Plxna1 UTSW 6 89324400 missense probably damaging 0.97
R6701:Plxna1 UTSW 6 89319448 missense probably damaging 0.99
R6825:Plxna1 UTSW 6 89320615 missense probably benign 0.01
R6911:Plxna1 UTSW 6 89320974 missense probably damaging 1.00
R7073:Plxna1 UTSW 6 89357329 missense probably damaging 1.00
R7177:Plxna1 UTSW 6 89323329 missense possibly damaging 0.50
R7235:Plxna1 UTSW 6 89340591 missense probably damaging 0.97
R7419:Plxna1 UTSW 6 89357602 missense unknown
R7511:Plxna1 UTSW 6 89341907 missense possibly damaging 0.71
R7543:Plxna1 UTSW 6 89322855 missense probably damaging 1.00
S24628:Plxna1 UTSW 6 89357336 missense probably benign 0.12
V8831:Plxna1 UTSW 6 89357137 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAAACCACTGTCACCCTGTCTC -3'
(R):5'- ACCCTCCAACAAGTTGCTCTATGC -3'

Sequencing Primer
(F):5'- CTAGGAAAATCTGGGCTGTCAGATAC -3'
(R):5'- CAAGTTGCTCTATGCCAAGG -3'
Posted On2013-04-16