Incidental Mutation 'R2049:Agxt'
ID226171
Institutional Source Beutler Lab
Gene Symbol Agxt
Ensembl Gene ENSMUSG00000026272
Gene Namealanine-glyoxylate aminotransferase
SynonymsAgxt1, Agt1
MMRRC Submission 040056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R2049 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location93135240-93145421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93137315 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 149 (I149V)
Ref Sequence ENSEMBL: ENSMUSP00000027491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027491]
PDB Structure
Crystal structure of Putative aminotransferase (AAH25799.1) from MUS MUSCULUS at 1.65 A resolution [X-RAY DIFFRACTION]
Crystal structure of Putative aminotransferase (AAH25799.1) from MUS MUSCULUS at 1.80 A resolution [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027491
AA Change: I149V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027491
Gene: ENSMUSG00000026272
AA Change: I149V

DomainStartEndE-ValueType
Pfam:Aminotran_5 45 398 3.3e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191039
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (118/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed only in the liver and the encoded protein is localized mostly in the peroxisomes, where it is involved in glyoxylate detoxification. Mutations in this gene, some of which alter subcellular targetting, have been associated with type I primary hyperoxaluria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased urinary oxalate levels and male mice suffer from bladder stones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,584,987 R8* probably null Het
Abhd17a A G 10: 80,585,606 probably null Het
Acsm1 A G 7: 119,656,039 R415G probably damaging Het
Acta1 G T 8: 123,892,064 T360N probably benign Het
Adam6a T A 12: 113,544,429 S141T probably benign Het
Adgrd1 G T 5: 129,115,095 K76N probably benign Het
Afdn A G 17: 13,810,433 E202G probably damaging Het
Agps T A 2: 75,858,926 M156K probably benign Het
Aqp2 A G 15: 99,579,366 T72A probably damaging Het
Arhgap18 T A 10: 26,849,942 D54E probably benign Het
Asb8 C A 15: 98,136,069 E202* probably null Het
Bmp5 A G 9: 75,893,790 I401V probably damaging Het
Bscl2 T C 19: 8,845,320 probably null Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cep112 A G 11: 108,606,325 E697G probably damaging Het
Cerk G A 15: 86,142,808 S167L probably benign Het
Chrm3 T A 13: 9,878,335 I222F probably damaging Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Commd10 A T 18: 46,963,747 T74S probably benign Het
Cyp4f39 T C 17: 32,482,138 F201L probably benign Het
Dennd4a A G 9: 64,889,605 T860A possibly damaging Het
Dlg5 A T 14: 24,154,647 I1253N probably damaging Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Dnah9 A G 11: 66,044,683 M1970T probably damaging Het
Doxl2 T A 6: 48,977,755 L609* probably null Het
Dsc3 A T 18: 19,989,680 D62E possibly damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dusp7 C T 9: 106,373,897 T407M probably damaging Het
Efnb1 A G X: 99,147,517 Y343C probably damaging Het
Entpd5 A G 12: 84,396,858 I12T probably benign Het
Espn T C 4: 152,121,257 E408G probably damaging Het
Fam160a2 A T 7: 105,389,839 D64E probably damaging Het
Gdpd3 A G 7: 126,768,594 T200A probably damaging Het
Gli1 A G 10: 127,336,727 L182P probably damaging Het
Gm4907 T A X: 23,907,310 V350E probably benign Het
Gm5134 G A 10: 76,004,884 A521T possibly damaging Het
Gm8300 A G 12: 87,517,276 D127G unknown Het
Gm960 A G 19: 4,698,605 probably benign Het
Gprasp1 G A X: 135,802,042 E995K possibly damaging Het
H2-M10.1 T C 17: 36,325,216 D153G possibly damaging Het
Helb A T 10: 120,106,021 M254K possibly damaging Het
I0C0044D17Rik A G 4: 98,820,296 probably benign Het
Igfn1 T A 1: 135,970,638 Q730L probably benign Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jmjd1c T A 10: 67,157,998 L86* probably null Het
Kat5 T A 19: 5,605,685 probably null Het
Kif14 A G 1: 136,487,080 N768S probably benign Het
Kif14 A G 1: 136,510,167 E1199G possibly damaging Het
Klhl29 A G 12: 5,137,876 S163P probably damaging Het
Kmt2c C A 5: 25,285,079 Q4287H probably damaging Het
Krt82 T A 15: 101,545,156 Q265L probably damaging Het
Macf1 C T 4: 123,355,102 C7210Y probably damaging Het
Mx2 G A 16: 97,538,703 E20K probably benign Het
Myom2 T G 8: 15,106,379 I742S probably damaging Het
Narf A T 11: 121,250,369 R310* probably null Het
Nktr T A 9: 121,741,694 D167E probably damaging Het
Nle1 A G 11: 82,905,366 W183R probably damaging Het
Npas3 A G 12: 54,062,088 N425S probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1197 A T 2: 88,728,745 Y285N probably damaging Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr283 G A 15: 98,378,396 T238I possibly damaging Het
Olfr816 A G 10: 129,912,167 V37A probably benign Het
Olfr965 A T 9: 39,720,115 D296V probably damaging Het
Olfr984 T A 9: 40,101,119 I124L probably benign Het
Optc A T 1: 133,903,796 probably null Het
Otol1 T A 3: 70,018,836 F115I probably benign Het
Parp8 T A 13: 116,894,886 D430V probably benign Het
Pex7 T A 10: 19,894,315 H123L probably damaging Het
Pkhd1l1 T A 15: 44,547,513 probably benign Het
Pkhd1l1 G A 15: 44,581,741 D3670N probably damaging Het
Plec T C 15: 76,183,174 T1331A probably benign Het
Plekha4 A G 7: 45,553,798 D704G probably benign Het
Plxnb2 T A 15: 89,159,002 N1453I probably damaging Het
Pms1 T A 1: 53,281,988 I29F probably damaging Het
Ppp1r1a G A 15: 103,531,406 T153I probably damaging Het
Pramef8 T A 4: 143,416,871 L69Q probably damaging Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptpre A G 7: 135,670,695 probably benign Het
Ptprt A T 2: 161,534,545 I1312N probably damaging Het
Ren1 C G 1: 133,350,778 probably null Het
Rims1 C T 1: 22,596,435 C155Y probably damaging Het
Slitrk6 T G 14: 110,750,794 T494P probably benign Het
Sltm G A 9: 70,581,301 G578S probably benign Het
Smyd5 A G 6: 85,444,318 E338G probably benign Het
Snx2 G A 18: 53,194,444 V81M probably damaging Het
Sp2 G T 11: 96,961,365 N244K probably benign Het
Sspo C A 6: 48,460,763 probably benign Het
Sspo A C 6: 48,463,531 D1568A probably benign Het
Ssrp1 T C 2: 85,041,427 probably benign Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Syt7 G A 19: 10,439,213 R138Q probably benign Het
Taar7f T C 10: 24,050,425 Y306H possibly damaging Het
Tbccd1 T C 16: 22,818,541 probably null Het
Tex261 A G 6: 83,772,259 Y119H probably damaging Het
Tmem131l T G 3: 83,942,788 E234D probably damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubap1 C T 4: 41,379,257 A157V probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Uso1 G A 5: 92,181,936 G427R probably damaging Het
Usp15 A T 10: 123,119,137 V912D probably damaging Het
Vmn1r20 T C 6: 57,431,958 S90P probably damaging Het
Vmn1r32 T C 6: 66,553,561 K77R probably damaging Het
Vmn2r100 A G 17: 19,522,050 K229E probably benign Het
Vmn2r106 A G 17: 20,268,304 V611A possibly damaging Het
Xrcc6 T A 15: 82,022,977 F167I probably damaging Het
Zbtb21 G T 16: 97,950,155 P804H probably damaging Het
Zdhhc3 T C 9: 123,100,537 D11G probably damaging Het
Zfhx3 A G 8: 108,945,177 T1324A probably benign Het
Zfp281 GCGGCAGCTCCGGCAGC GCGGCAGCTCCGGCAGCTCCGGCAGC 1: 136,625,353 probably benign Het
Zfp608 G T 18: 54,895,565 L1259I probably damaging Het
Other mutations in Agxt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02375:Agxt APN 1 93135703 missense probably damaging 1.00
IGL02938:Agxt APN 1 93145109 missense probably damaging 1.00
R1004:Agxt UTSW 1 93135699 missense possibly damaging 0.94
R1511:Agxt UTSW 1 93135768 missense probably damaging 1.00
R1539:Agxt UTSW 1 93137979 missense probably damaging 0.98
R2407:Agxt UTSW 1 93135780 missense probably benign 0.25
R4910:Agxt UTSW 1 93135714 missense probably benign 0.01
R5013:Agxt UTSW 1 93142057 splice site probably benign
R5098:Agxt UTSW 1 93137307 missense probably benign 0.00
R6794:Agxt UTSW 1 93135382 missense possibly damaging 0.88
R7221:Agxt UTSW 1 93137901 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GCCATGTGAGAGCCAGAATG -3'
(R):5'- ACTTCCAAACTGATCCTGGG -3'

Sequencing Primer
(F):5'- TGCCAATTACACTGGGGCATC -3'
(R):5'- CTTCCAAACTGATCCTGGGTATAGG -3'
Posted On2014-09-17