Incidental Mutation 'R2049:Zfp281'
ID226190
Institutional Source Beutler Lab
Gene Symbol Zfp281
Ensembl Gene ENSMUSG00000041483
Gene Namezinc finger protein 281
Synonyms
MMRRC Submission 040056-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2049 (G1)
Quality Score129
Status Validated
Chromosome1
Chromosomal Location136624901-136630053 bp(+) (GRCm38)
Type of Mutationsmall insertion (3 aa in frame mutation)
DNA Base Change (assembly) GCGGCAGCTCCGGCAGC to GCGGCAGCTCCGGCAGCTCCGGCAGC at 136625353 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047734] [ENSMUST00000112046]
Predicted Effect probably benign
Transcript: ENSMUST00000047734
SMART Domains Protein: ENSMUSP00000039003
Gene: ENSMUSG00000041483

DomainStartEndE-ValueType
low complexity region 4 36 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 161 171 N/A INTRINSIC
low complexity region 180 191 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
ZnF_C2H2 258 280 3.34e-2 SMART
ZnF_C2H2 286 308 6.78e-3 SMART
ZnF_C2H2 314 336 1.43e-1 SMART
ZnF_C2H2 342 362 2.97e1 SMART
low complexity region 397 407 N/A INTRINSIC
low complexity region 488 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112046
SMART Domains Protein: ENSMUSP00000107677
Gene: ENSMUSG00000041483

DomainStartEndE-ValueType
low complexity region 4 36 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 161 171 N/A INTRINSIC
low complexity region 180 191 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
ZnF_C2H2 258 280 3.34e-2 SMART
ZnF_C2H2 286 308 6.78e-3 SMART
ZnF_C2H2 314 336 1.43e-1 SMART
ZnF_C2H2 342 362 2.97e1 SMART
low complexity region 397 407 N/A INTRINSIC
low complexity region 488 501 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180797
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (118/122)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E7.5 and E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,584,987 R8* probably null Het
Abhd17a A G 10: 80,585,606 probably null Het
Acsm1 A G 7: 119,656,039 R415G probably damaging Het
Acta1 G T 8: 123,892,064 T360N probably benign Het
Adam6a T A 12: 113,544,429 S141T probably benign Het
Adgrd1 G T 5: 129,115,095 K76N probably benign Het
Afdn A G 17: 13,810,433 E202G probably damaging Het
Agps T A 2: 75,858,926 M156K probably benign Het
Agxt A G 1: 93,137,315 I149V probably benign Het
Aqp2 A G 15: 99,579,366 T72A probably damaging Het
Arhgap18 T A 10: 26,849,942 D54E probably benign Het
Asb8 C A 15: 98,136,069 E202* probably null Het
Bmp5 A G 9: 75,893,790 I401V probably damaging Het
Bscl2 T C 19: 8,845,320 probably null Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cep112 A G 11: 108,606,325 E697G probably damaging Het
Cerk G A 15: 86,142,808 S167L probably benign Het
Chrm3 T A 13: 9,878,335 I222F probably damaging Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Commd10 A T 18: 46,963,747 T74S probably benign Het
Cyp4f39 T C 17: 32,482,138 F201L probably benign Het
Dennd4a A G 9: 64,889,605 T860A possibly damaging Het
Dlg5 A T 14: 24,154,647 I1253N probably damaging Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Dnah9 A G 11: 66,044,683 M1970T probably damaging Het
Doxl2 T A 6: 48,977,755 L609* probably null Het
Dsc3 A T 18: 19,989,680 D62E possibly damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dusp7 C T 9: 106,373,897 T407M probably damaging Het
Efnb1 A G X: 99,147,517 Y343C probably damaging Het
Entpd5 A G 12: 84,396,858 I12T probably benign Het
Espn T C 4: 152,121,257 E408G probably damaging Het
Fam160a2 A T 7: 105,389,839 D64E probably damaging Het
Gdpd3 A G 7: 126,768,594 T200A probably damaging Het
Gli1 A G 10: 127,336,727 L182P probably damaging Het
Gm4907 T A X: 23,907,310 V350E probably benign Het
Gm5134 G A 10: 76,004,884 A521T possibly damaging Het
Gm8300 A G 12: 87,517,276 D127G unknown Het
Gm960 A G 19: 4,698,605 probably benign Het
Gprasp1 G A X: 135,802,042 E995K possibly damaging Het
H2-M10.1 T C 17: 36,325,216 D153G possibly damaging Het
Helb A T 10: 120,106,021 M254K possibly damaging Het
I0C0044D17Rik A G 4: 98,820,296 probably benign Het
Igfn1 T A 1: 135,970,638 Q730L probably benign Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jmjd1c T A 10: 67,157,998 L86* probably null Het
Kat5 T A 19: 5,605,685 probably null Het
Kif14 A G 1: 136,510,167 E1199G possibly damaging Het
Kif14 A G 1: 136,487,080 N768S probably benign Het
Klhl29 A G 12: 5,137,876 S163P probably damaging Het
Kmt2c C A 5: 25,285,079 Q4287H probably damaging Het
Krt82 T A 15: 101,545,156 Q265L probably damaging Het
Macf1 C T 4: 123,355,102 C7210Y probably damaging Het
Mx2 G A 16: 97,538,703 E20K probably benign Het
Myom2 T G 8: 15,106,379 I742S probably damaging Het
Narf A T 11: 121,250,369 R310* probably null Het
Nktr T A 9: 121,741,694 D167E probably damaging Het
Nle1 A G 11: 82,905,366 W183R probably damaging Het
Npas3 A G 12: 54,062,088 N425S probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1197 A T 2: 88,728,745 Y285N probably damaging Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr283 G A 15: 98,378,396 T238I possibly damaging Het
Olfr816 A G 10: 129,912,167 V37A probably benign Het
Olfr965 A T 9: 39,720,115 D296V probably damaging Het
Olfr984 T A 9: 40,101,119 I124L probably benign Het
Optc A T 1: 133,903,796 probably null Het
Otol1 T A 3: 70,018,836 F115I probably benign Het
Parp8 T A 13: 116,894,886 D430V probably benign Het
Pex7 T A 10: 19,894,315 H123L probably damaging Het
Pkhd1l1 G A 15: 44,581,741 D3670N probably damaging Het
Pkhd1l1 T A 15: 44,547,513 probably benign Het
Plec T C 15: 76,183,174 T1331A probably benign Het
Plekha4 A G 7: 45,553,798 D704G probably benign Het
Plxnb2 T A 15: 89,159,002 N1453I probably damaging Het
Pms1 T A 1: 53,281,988 I29F probably damaging Het
Ppp1r1a G A 15: 103,531,406 T153I probably damaging Het
Pramef8 T A 4: 143,416,871 L69Q probably damaging Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptpre A G 7: 135,670,695 probably benign Het
Ptprt A T 2: 161,534,545 I1312N probably damaging Het
Ren1 C G 1: 133,350,778 probably null Het
Rims1 C T 1: 22,596,435 C155Y probably damaging Het
Slitrk6 T G 14: 110,750,794 T494P probably benign Het
Sltm G A 9: 70,581,301 G578S probably benign Het
Smyd5 A G 6: 85,444,318 E338G probably benign Het
Snx2 G A 18: 53,194,444 V81M probably damaging Het
Sp2 G T 11: 96,961,365 N244K probably benign Het
Sspo C A 6: 48,460,763 probably benign Het
Sspo A C 6: 48,463,531 D1568A probably benign Het
Ssrp1 T C 2: 85,041,427 probably benign Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Syt7 G A 19: 10,439,213 R138Q probably benign Het
Taar7f T C 10: 24,050,425 Y306H possibly damaging Het
Tbccd1 T C 16: 22,818,541 probably null Het
Tex261 A G 6: 83,772,259 Y119H probably damaging Het
Tmem131l T G 3: 83,942,788 E234D probably damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubap1 C T 4: 41,379,257 A157V probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Uso1 G A 5: 92,181,936 G427R probably damaging Het
Usp15 A T 10: 123,119,137 V912D probably damaging Het
Vmn1r20 T C 6: 57,431,958 S90P probably damaging Het
Vmn1r32 T C 6: 66,553,561 K77R probably damaging Het
Vmn2r100 A G 17: 19,522,050 K229E probably benign Het
Vmn2r106 A G 17: 20,268,304 V611A possibly damaging Het
Xrcc6 T A 15: 82,022,977 F167I probably damaging Het
Zbtb21 G T 16: 97,950,155 P804H probably damaging Het
Zdhhc3 T C 9: 123,100,537 D11G probably damaging Het
Zfhx3 A G 8: 108,945,177 T1324A probably benign Het
Zfp608 G T 18: 54,895,565 L1259I probably damaging Het
Other mutations in Zfp281
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Zfp281 APN 1 136627910 missense probably damaging 1.00
IGL01408:Zfp281 APN 1 136626115 missense probably damaging 1.00
IGL02037:Zfp281 APN 1 136627447 missense possibly damaging 0.64
IGL03233:Zfp281 APN 1 136626829 missense possibly damaging 0.82
PIT4486001:Zfp281 UTSW 1 136627003 missense possibly damaging 0.48
R1514:Zfp281 UTSW 1 136626697 missense probably benign 0.00
R1784:Zfp281 UTSW 1 136625353 small insertion probably benign
R1785:Zfp281 UTSW 1 136625353 small insertion probably benign
R2142:Zfp281 UTSW 1 136625353 small insertion probably benign
R4086:Zfp281 UTSW 1 136626121 missense probably damaging 1.00
R4087:Zfp281 UTSW 1 136626121 missense probably damaging 1.00
R4088:Zfp281 UTSW 1 136626121 missense probably damaging 1.00
R4090:Zfp281 UTSW 1 136626121 missense probably damaging 1.00
R4819:Zfp281 UTSW 1 136625710 missense probably benign
R5380:Zfp281 UTSW 1 136625938 missense possibly damaging 0.93
R6033:Zfp281 UTSW 1 136626726 missense probably benign 0.14
R6033:Zfp281 UTSW 1 136626726 missense probably benign 0.14
R6056:Zfp281 UTSW 1 136625440 missense possibly damaging 0.93
R6213:Zfp281 UTSW 1 136625512 missense probably benign 0.01
R7402:Zfp281 UTSW 1 136625452 missense probably damaging 0.99
R7503:Zfp281 UTSW 1 136626940 missense possibly damaging 0.67
R7969:Zfp281 UTSW 1 136626034 missense probably benign 0.06
R8343:Zfp281 UTSW 1 136627882 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGGGGAGGCTTTTAATTC -3'
(R):5'- AGGAGGATAACACGCACTGC -3'

Sequencing Primer
(F):5'- TTATTAACTGGAGGCGACGGC -3'
(R):5'- AGCCGGTGGTTGAACATA -3'
Posted On2014-09-17