Incidental Mutation 'R2049:Myom2'
ID226226
Institutional Source Beutler Lab
Gene Symbol Myom2
Ensembl Gene ENSMUSG00000031461
Gene Namemyomesin 2
Synonyms
MMRRC Submission 040056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R2049 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location15057653-15133541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 15106379 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 742 (I742S)
Ref Sequence ENSEMBL: ENSMUSP00000033842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033842]
Predicted Effect probably damaging
Transcript: ENSMUST00000033842
AA Change: I742S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033842
Gene: ENSMUSG00000031461
AA Change: I742S

DomainStartEndE-ValueType
low complexity region 34 63 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
coiled coil region 97 129 N/A INTRINSIC
IG 160 247 7.7e-5 SMART
IG 284 373 8.01e-3 SMART
FN3 383 466 1.5e-14 SMART
FN3 511 594 1.79e-12 SMART
FN3 612 693 1.95e-13 SMART
FN3 711 794 8.69e-11 SMART
FN3 813 896 1.86e-10 SMART
IG_like 913 999 1.58e2 SMART
Blast:IG_like 1021 1106 1e-44 BLAST
IG_like 1135 1215 2.27e1 SMART
Blast:IG_like 1227 1321 9e-51 BLAST
IGc2 1357 1425 4.96e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135393
Meta Mutation Damage Score 0.3930 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (118/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,584,987 R8* probably null Het
Abhd17a A G 10: 80,585,606 probably null Het
Acsm1 A G 7: 119,656,039 R415G probably damaging Het
Acta1 G T 8: 123,892,064 T360N probably benign Het
Adam6a T A 12: 113,544,429 S141T probably benign Het
Adgrd1 G T 5: 129,115,095 K76N probably benign Het
Afdn A G 17: 13,810,433 E202G probably damaging Het
Agps T A 2: 75,858,926 M156K probably benign Het
Agxt A G 1: 93,137,315 I149V probably benign Het
Aqp2 A G 15: 99,579,366 T72A probably damaging Het
Arhgap18 T A 10: 26,849,942 D54E probably benign Het
Asb8 C A 15: 98,136,069 E202* probably null Het
Bmp5 A G 9: 75,893,790 I401V probably damaging Het
Bscl2 T C 19: 8,845,320 probably null Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cep112 A G 11: 108,606,325 E697G probably damaging Het
Cerk G A 15: 86,142,808 S167L probably benign Het
Chrm3 T A 13: 9,878,335 I222F probably damaging Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Commd10 A T 18: 46,963,747 T74S probably benign Het
Cyp4f39 T C 17: 32,482,138 F201L probably benign Het
Dennd4a A G 9: 64,889,605 T860A possibly damaging Het
Dlg5 A T 14: 24,154,647 I1253N probably damaging Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Dnah9 A G 11: 66,044,683 M1970T probably damaging Het
Doxl2 T A 6: 48,977,755 L609* probably null Het
Dsc3 A T 18: 19,989,680 D62E possibly damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dusp7 C T 9: 106,373,897 T407M probably damaging Het
Efnb1 A G X: 99,147,517 Y343C probably damaging Het
Entpd5 A G 12: 84,396,858 I12T probably benign Het
Espn T C 4: 152,121,257 E408G probably damaging Het
Fam160a2 A T 7: 105,389,839 D64E probably damaging Het
Gdpd3 A G 7: 126,768,594 T200A probably damaging Het
Gli1 A G 10: 127,336,727 L182P probably damaging Het
Gm4907 T A X: 23,907,310 V350E probably benign Het
Gm5134 G A 10: 76,004,884 A521T possibly damaging Het
Gm8300 A G 12: 87,517,276 D127G unknown Het
Gm960 A G 19: 4,698,605 probably benign Het
Gprasp1 G A X: 135,802,042 E995K possibly damaging Het
H2-M10.1 T C 17: 36,325,216 D153G possibly damaging Het
Helb A T 10: 120,106,021 M254K possibly damaging Het
I0C0044D17Rik A G 4: 98,820,296 probably benign Het
Igfn1 T A 1: 135,970,638 Q730L probably benign Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jmjd1c T A 10: 67,157,998 L86* probably null Het
Kat5 T A 19: 5,605,685 probably null Het
Kif14 A G 1: 136,487,080 N768S probably benign Het
Kif14 A G 1: 136,510,167 E1199G possibly damaging Het
Klhl29 A G 12: 5,137,876 S163P probably damaging Het
Kmt2c C A 5: 25,285,079 Q4287H probably damaging Het
Krt82 T A 15: 101,545,156 Q265L probably damaging Het
Macf1 C T 4: 123,355,102 C7210Y probably damaging Het
Mx2 G A 16: 97,538,703 E20K probably benign Het
Narf A T 11: 121,250,369 R310* probably null Het
Nktr T A 9: 121,741,694 D167E probably damaging Het
Nle1 A G 11: 82,905,366 W183R probably damaging Het
Npas3 A G 12: 54,062,088 N425S probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1197 A T 2: 88,728,745 Y285N probably damaging Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr283 G A 15: 98,378,396 T238I possibly damaging Het
Olfr816 A G 10: 129,912,167 V37A probably benign Het
Olfr965 A T 9: 39,720,115 D296V probably damaging Het
Olfr984 T A 9: 40,101,119 I124L probably benign Het
Optc A T 1: 133,903,796 probably null Het
Otol1 T A 3: 70,018,836 F115I probably benign Het
Parp8 T A 13: 116,894,886 D430V probably benign Het
Pex7 T A 10: 19,894,315 H123L probably damaging Het
Pkhd1l1 T A 15: 44,547,513 probably benign Het
Pkhd1l1 G A 15: 44,581,741 D3670N probably damaging Het
Plec T C 15: 76,183,174 T1331A probably benign Het
Plekha4 A G 7: 45,553,798 D704G probably benign Het
Plxnb2 T A 15: 89,159,002 N1453I probably damaging Het
Pms1 T A 1: 53,281,988 I29F probably damaging Het
Ppp1r1a G A 15: 103,531,406 T153I probably damaging Het
Pramef8 T A 4: 143,416,871 L69Q probably damaging Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptpre A G 7: 135,670,695 probably benign Het
Ptprt A T 2: 161,534,545 I1312N probably damaging Het
Ren1 C G 1: 133,350,778 probably null Het
Rims1 C T 1: 22,596,435 C155Y probably damaging Het
Slitrk6 T G 14: 110,750,794 T494P probably benign Het
Sltm G A 9: 70,581,301 G578S probably benign Het
Smyd5 A G 6: 85,444,318 E338G probably benign Het
Snx2 G A 18: 53,194,444 V81M probably damaging Het
Sp2 G T 11: 96,961,365 N244K probably benign Het
Sspo C A 6: 48,460,763 probably benign Het
Sspo A C 6: 48,463,531 D1568A probably benign Het
Ssrp1 T C 2: 85,041,427 probably benign Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Syt7 G A 19: 10,439,213 R138Q probably benign Het
Taar7f T C 10: 24,050,425 Y306H possibly damaging Het
Tbccd1 T C 16: 22,818,541 probably null Het
Tex261 A G 6: 83,772,259 Y119H probably damaging Het
Tmem131l T G 3: 83,942,788 E234D probably damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubap1 C T 4: 41,379,257 A157V probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Uso1 G A 5: 92,181,936 G427R probably damaging Het
Usp15 A T 10: 123,119,137 V912D probably damaging Het
Vmn1r20 T C 6: 57,431,958 S90P probably damaging Het
Vmn1r32 T C 6: 66,553,561 K77R probably damaging Het
Vmn2r100 A G 17: 19,522,050 K229E probably benign Het
Vmn2r106 A G 17: 20,268,304 V611A possibly damaging Het
Xrcc6 T A 15: 82,022,977 F167I probably damaging Het
Zbtb21 G T 16: 97,950,155 P804H probably damaging Het
Zdhhc3 T C 9: 123,100,537 D11G probably damaging Het
Zfhx3 A G 8: 108,945,177 T1324A probably benign Het
Zfp281 GCGGCAGCTCCGGCAGC GCGGCAGCTCCGGCAGCTCCGGCAGC 1: 136,625,353 probably benign Het
Zfp608 G T 18: 54,895,565 L1259I probably damaging Het
Other mutations in Myom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom2 APN 8 15069490 missense probably damaging 1.00
IGL00426:Myom2 APN 8 15069502 missense probably benign 0.00
IGL00503:Myom2 APN 8 15114289 splice site probably null
IGL01515:Myom2 APN 8 15122655 missense probably benign 0.15
IGL01649:Myom2 APN 8 15113755 missense probably benign 0.24
IGL01658:Myom2 APN 8 15077880 missense probably damaging 1.00
IGL01786:Myom2 APN 8 15106330 missense probably damaging 0.99
IGL01924:Myom2 APN 8 15069685 missense probably benign 0.37
IGL01929:Myom2 APN 8 15117698 missense probably damaging 0.96
IGL02016:Myom2 APN 8 15125195 missense probably benign 0.01
IGL02511:Myom2 APN 8 15065743 missense probably benign
IGL02558:Myom2 APN 8 15114237 missense probably benign 0.31
IGL02944:Myom2 APN 8 15104065 critical splice acceptor site probably null
IGL03052:Myom2 APN 8 15123442 splice site probably benign
IGL03195:Myom2 APN 8 15111844 nonsense probably null
IGL03288:Myom2 APN 8 15122679 missense probably damaging 0.99
IGL03402:Myom2 APN 8 15065731 missense probably benign
R0069:Myom2 UTSW 8 15117624 missense probably benign
R0116:Myom2 UTSW 8 15117633 missense probably damaging 1.00
R0131:Myom2 UTSW 8 15083329 missense probably damaging 0.98
R0373:Myom2 UTSW 8 15098419 missense possibly damaging 0.91
R0463:Myom2 UTSW 8 15104123 missense probably benign 0.09
R0544:Myom2 UTSW 8 15069796 missense probably damaging 1.00
R0629:Myom2 UTSW 8 15069783 missense probably damaging 0.98
R0634:Myom2 UTSW 8 15119216 splice site probably benign
R0645:Myom2 UTSW 8 15117698 missense probably damaging 0.96
R0730:Myom2 UTSW 8 15099326 missense probably benign 0.00
R0744:Myom2 UTSW 8 15132924 nonsense probably null
R0836:Myom2 UTSW 8 15132924 nonsense probably null
R1033:Myom2 UTSW 8 15108934 missense probably benign 0.04
R1103:Myom2 UTSW 8 15110827 missense probably benign 0.22
R1110:Myom2 UTSW 8 15122413 missense probably benign 0.44
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1353:Myom2 UTSW 8 15106424 missense probably damaging 1.00
R1530:Myom2 UTSW 8 15122384 missense probably damaging 1.00
R1544:Myom2 UTSW 8 15104059 splice site probably benign
R1576:Myom2 UTSW 8 15084556 missense probably damaging 1.00
R1758:Myom2 UTSW 8 15065795 missense probably benign 0.00
R1884:Myom2 UTSW 8 15114278 missense probably benign 0.01
R1908:Myom2 UTSW 8 15081023 missense probably damaging 1.00
R1962:Myom2 UTSW 8 15132599 intron probably null
R1977:Myom2 UTSW 8 15085263 missense possibly damaging 0.47
R2018:Myom2 UTSW 8 15131151 missense probably damaging 1.00
R2155:Myom2 UTSW 8 15084555 missense probably damaging 0.98
R2314:Myom2 UTSW 8 15063927 missense probably damaging 0.99
R2350:Myom2 UTSW 8 15108835 missense probably benign 0.09
R2358:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R2904:Myom2 UTSW 8 15098348 missense probably benign 0.00
R3418:Myom2 UTSW 8 15085294 missense probably benign 0.01
R3606:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3607:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3735:Myom2 UTSW 8 15069676 missense probably benign 0.01
R3756:Myom2 UTSW 8 15102650 missense probably benign 0.11
R3902:Myom2 UTSW 8 15104165 missense probably benign
R3951:Myom2 UTSW 8 15084556 missense probably benign 0.35
R4240:Myom2 UTSW 8 15132895 missense probably benign 0.10
R4361:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R4581:Myom2 UTSW 8 15106459 missense probably benign 0.02
R4736:Myom2 UTSW 8 15081271 missense probably damaging 0.99
R5010:Myom2 UTSW 8 15083310 missense probably damaging 0.98
R5108:Myom2 UTSW 8 15132667 missense probably damaging 0.99
R5370:Myom2 UTSW 8 15099343 missense probably benign 0.10
R5427:Myom2 UTSW 8 15113764 missense probably benign 0.03
R5498:Myom2 UTSW 8 15129142 missense probably benign 0.01
R5504:Myom2 UTSW 8 15128879 missense probably damaging 1.00
R5567:Myom2 UTSW 8 15102546 missense probably benign 0.01
R5743:Myom2 UTSW 8 15080914 missense possibly damaging 0.82
R5745:Myom2 UTSW 8 15122705 missense probably benign 0.01
R5844:Myom2 UTSW 8 15131182 critical splice donor site probably null
R5854:Myom2 UTSW 8 15108478 missense probably benign
R6141:Myom2 UTSW 8 15063903 missense probably damaging 1.00
R6209:Myom2 UTSW 8 15104173 missense possibly damaging 0.76
R6248:Myom2 UTSW 8 15098472 splice site probably null
R6378:Myom2 UTSW 8 15099356 missense probably benign 0.11
R6829:Myom2 UTSW 8 15122643 nonsense probably null
R6913:Myom2 UTSW 8 15065710 missense probably benign
R6957:Myom2 UTSW 8 15117741 missense probably null 0.42
R6958:Myom2 UTSW 8 15117741 missense probably null 0.42
R6960:Myom2 UTSW 8 15117741 missense probably null 0.42
R6961:Myom2 UTSW 8 15117741 missense probably null 0.42
R6962:Myom2 UTSW 8 15117741 missense probably null 0.42
R6999:Myom2 UTSW 8 15084531 missense probably benign 0.22
R7148:Myom2 UTSW 8 15084577 missense possibly damaging 0.72
R7210:Myom2 UTSW 8 15104114 missense probably damaging 1.00
R7298:Myom2 UTSW 8 15098411 missense probably damaging 1.00
R7463:Myom2 UTSW 8 15117679 missense probably null 0.94
R7535:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7573:Myom2 UTSW 8 15122450 missense probably damaging 1.00
R7590:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7690:Myom2 UTSW 8 15111717 critical splice acceptor site probably null
R7794:Myom2 UTSW 8 15083259 missense probably damaging 1.00
R7822:Myom2 UTSW 8 15108454 missense probably benign
R7948:Myom2 UTSW 8 15085306 missense probably benign 0.00
RF001:Myom2 UTSW 8 15081418 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CCTGTGACTCTAGAGCTGACTG -3'
(R):5'- ACCATGCCCTCTTAATTCTAGG -3'

Sequencing Primer
(F):5'- GACTCTAGAGCTGACTGATTGG -3'
(R):5'- CTACTTTGTCAGGATCAAGGGACC -3'
Posted On2014-09-17